База ГОСТовallgosts.ru » 07. МАТЕМАТИКА. ЕСТЕСТВЕННЫЕ НАУКИ » 07.100. Микробиология

ГОСТ ISO/TS 13136-2016 Микробиология пищевой продукции и кормов для животных. Полимеразная цепная реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп O157, O111, O26, O103 и O145

Обозначение: ГОСТ ISO/TS 13136-2016
Наименование: Микробиология пищевой продукции и кормов для животных. Полимеразная цепная реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп O157, O111, O26, O103 и O145
Статус: Действует

Дата введения: 07/01/2017
Дата отмены: -
Заменен на: -
Код ОКС: 07.100.30, 65.120, 67.050
Скачать PDF: ГОСТ ISO/TS 13136-2016 Микробиология пищевой продукции и кормов для животных. Полимеразная цепная реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп O157, O111, O26, O103 и O145.pdf
Скачать Word:ГОСТ ISO/TS 13136-2016 Микробиология пищевой продукции и кормов для животных. Полимеразная цепная реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп O157, O111, O26, O103 и O145.doc


Текст ГОСТ ISO/TS 13136-2016 Микробиология пищевой продукции и кормов для животных. Полимеразная цепная реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп O157, O111, O26, O103 и O145



МЕЖГОСУДАРСТВЕННЫЙ СОВЕТ ПО СТАНДАРТИЗАЦИИ, МЕТРОЛОГИИ И СЕРТИФИКАЦИИ

(МГС)

INTERSTATE COUNCIL FOR STANDARDIZATION, METROLOGY AND CERTIFICATION

(ISC)

МЕЖГОСУДАРСТВЕННЫЙ

СТАНДАРТ

ГОСТ

ISO/TS 13136-2016

Микробиология пищевой продукции и кормов

для животных

ПОЛИМЕРАЗНАЯ ЦЕПНАЯ РЕАКЦИЯ В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ ДЛЯ ОПРЕДЕЛЕНИЯ ПАТОГЕННЫХ МИКРООРГАНИЗМОВ

Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-токсин, в том числе серогрупп 0157, 0111, 026, 0103 и 0145

(ISO/TS 13136:2012, ЮТ)

Издание официальное

СШ1ЛТТМ|фП[М

201*

ГОСТ ISO/TS 13136—2016

Предисловие

Цели, основные принципы и основной порядок проведения работ по межгосударственной стандартизации установлены в ГОСТ 1.0—2015 Межгосударственная система стандартизации. Основные положения» и ГОСТ 1.2—2015 «Межгосударственная система стандартизации. Стандарты межгосударственные. правила и рекомендации по межгосударственной стандартизации. Правила разработки, принятия. обновления и отмены»

Сведения о стандарте

1    ПОДГОТОВЛЕН Федеральным государственным бюджетным научным учреждением «Всероссийский научно-исследовательский институт технологии консервирования» (ФГБНУ «ВНИИТеК») на основе официального перевода на русский язык англоязычной версии международного документа, указанного в пункте 5. который выполнен ФГБНУ «ВНИИТеК»

2    ВНЕСЕН Федеральным агентством по техническому регулированию и метрологии

3    ПРИНЯТ Межгосударственным советом по стандартизации, метрологии и сертификации (протокол от 27 июля 2016 г. Nc 89-П)

За принятие проголосовали:

Краткое наименование страны по МК (ИСО 3166) 004—97

Код страны по МК (ИСО 3166)004- 97

Сокращенное нэиысиооэнис национального органа по стандартизации

Армения

AM

Минэкономики Республики Армения

Беларусь

BY

Госстандарт Республики Беларусь

Киргизия

KG

Кыргызстандэрт

Молдова

MD

Молдоеа-Стандарт

Россия

RU

Россгандарт

4    Приказом Федерального агентства по техническому регулированию и метрологии от 7 ноября 2016 г. No 1606-ст межгосударственный стандарт ГОСТ ISO/TS 13136—2016 введен в действие в качестве национального стандарта Российской Федерации с 1 июля 2017 г.

5    Настоящий стандарт идентичен международному документу ISO/TS 13136:2012 «Микробиология пищевой продукции и кормов для животных. Полимеразная цепкая реакция в режиме реального времени для определения патогенных микроорганизмов. Горизонтальный метод определения бактерий Escherichia coli, продуцирующих Шига-гоксин, в том числе серогрулп 0157. 0111. 026. 0103 и 0145» (Microbiology of food and animal feed — Real-time polymerase chain reaction (PCR>-based method for the detection of food-borne pathogens — Horizontal method for the detection of Shiga toxin-producing Escherichia coli (STEC) and the determination of 0157.0111. 026.0103 and 0145 serogroups». IDT].

Международный документ разработан Техническим комитетом по стандартизации ISO/TC 34 «Пищевые продукты» Международной организации по стандартизации (ISO).

При применении настоящего стандарта рекомендуется использовать вместо ссылочных международных стандартов соответствующие им межгосударственные стандарты, сведения о которых приведены в дополнительном приложении ДА

6    ВВЕДЕН ВПЕРВЫЕ

Информация об изменениях х настоящему стандарту публикуется е ежегодном информационном указателе «Национальные стандарты» (по состоянию на 1 января текущего года), а текст изменений и поправок — в ежемесячном информационном указателе «Национальные стандарты». В случае лересмотрэ (замены) или отмены настоящего стандарта соответствующее уведомление будет опубликовано в ежемесячном информационном указателе «Национальные стандарты». Соответствующая информация, уведомление и тексты размещаются также в информационной системе общего пользования — на официальном сайте Федерального агентства по техническому регулированию и метрологии в сети Интернет ()

© Стандартинформ. 2016

В Российской Федерации настоящий стандарт не может быть полностью или частично воспроизведен. тиражирован и распространен в качестве официального издания без разрешения Федерального агентства по техническому регулированию и метрологии

II

ГОСТ ISO/TS 13136—2016

Содержание

1    Область применения .................................................................1

2    Нормативные ссылки .................................................................1

3    Термины и определения...............................................................2

4    Сущность метода ....................................................................2

5    Разбавители, питательные среды и реактивы..............................................3

6    Оборудование и лабораторная посуда...................................................4

7    Отбор проб..........................................................................5

8    Подготовка пробы для испытания.......................................................5

9    Методика проведения испытания .......................................................5

10    Интерпретация результатов...........................................................7

11    Эксплуатационные характеристики.....................................................7

Приложение А (обязательное) Блок-схема процедуры проведения анализа ....................11

Приложение В (обязательное) Блок-схема процедуры выделения и подтверждения .............12

Приложение С (справочное) Идентификация Escherichia со//, продуцирующих Шига-токсин (STEC).

путем выявления генов вирулентности мультиплексной ПЦР-амплифи нацией и обнаружение продуктов ПЦР путем электрофореза в агарозном геле...........13

Приложение D (справочное) Внутренний контроль амплификации............................16

Приложение Е (справочное) Праймеры и зонды для ПЦР-анализа............................17

Приложение F (обязательное) Выделение чистых штаммов STEC............................19

Приложение ДА (справочное) Сведения о соответствии ссылочных международных стандартов

межгосударственным стандартам.........................................20

Библиография........................................................................21

ГОСТ ISO/TS 13136—2016

Введение

Escherichia со//, продуцирующая Шига-токсин (STEC). является патогенной кишечной палочкой, которая может вызывать диарею, а также более тяжелые заболевания человека, такие как геморрагический колит и гемолитико-уремический синдром (ГУС). Хотя существует большое количество серо-rpynn STEC. серогруппы 0157. 026. ОШ. 0103 и 0145 гарантированно вызывают наиболее тяжелые заболевания, в частности. ГУС (см. [1]).

Примечание — Необходимо принимать во внимание все виды Escheochia coli, выделяющие Шига-токсин. поскольку они патогенны для человека и потенциально способны вызвать тяжелые заболевания в зависимости от характеристик рисков, которые несут в себе продоеотьственные товары (готовая к употреблению пищевая продукция или пищевая продукция, предназначенная для потребления после технологической обработки, такой как пастеризация, приготовление пищи и т. п.. проводимой с цепью снижения широкого спектра бактерий, присутствующих в пищевой продукции), а также от состояния здоровья людей, потребляющих пищевую продукцию.

Кроме того, учитывая высокую геномную пластичность данного вида бактерий, не исключено, что новые механизмы вирулентности могут приводить к созданию новых серопзтогрупп, таких как продуцирующая Шига-токсин энтероагрегагивная серопатогрулпа Е. coli 0104. которая вызвала вспышки ГУС в Германии и Франции в мае и июне 2011 г. Новые атипичные свропатогруппы Е. со/r могут образовываться в результате трансформации генов stx при воздействии бактериофага на штамм Е. coli. патогрулпы которого не продуцируют Шига-токсин.

Метод, установленный в настоящем стандарте, распространяется на данные атипичные штаммы и они могут быть надежно выявлены, поскольку в них присутствуют гены six.

IV

ГОСТ ISO/TS 13136—2016

МЕЖГОСУДАРСТВЕННЫЙ СТАНДАРТ

Микробиология пищевой продукции и кормов для животных

ПОЛИМЕРАЗНАЯ ЦЕПНАЯ РЕАКЦИЯ В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ ДЛЯ ОПРЕДЕЛЕНИЯ

ПАТОГЕННЫХ МИКРООРГАНИЗМОВ

Горизонтальный метод определения бактерий Escherichia coll, продуцирующих Шига-токсин, в том числе серогрупп 0157, 0111, 026, 0103 и 0145

Microbiology of food and animal feed. Real-time polymerase chain reaction (PCR)-based method for the detection of food-borne pathogens. Horizontal method for the detection of Shiga toxin-producing Escherichia coii (STEC) and the determination of 0157. ОП1. 026, 0103 and 0145 serogroups

Дата введения — 2017—07—01

1    Область применения

Настоящий стандарт устанавливает метод идентификации бактерий Escherichia coli. продуцирующих Шига-токсин (STEC), посредством обнаружения следующих генов:

a)    основных генов вирулентности STEC. stx и еав (см. (2). [3]):

b)    генов, входящих в состав ДНК бактерий Escherichia coii серогрупп 0157. 0111. 026. 0103 и 0145 (см. [3]. [4]).

При обнаружении одного или обоих видов генов six проводят разделение штаммов.

Выделение STEC из проб, в которых присутствуют бактерии с генами, характерными для серогрупп. на которые распространяется метод настоящего стандарта, можно упростить путем использования методик обогащения, предназначенных дпя работы с серогруппами (например, иммуномагнитного разделения).

В методе, установленном в настоящем стандарте, полимеразную цепную реакцию (ПЦР) в режиме реального времени используют в качестве контрольной методики обнаружения генов вирулентности и генов, присутствующих в геноме серогрупп.

Настоящий стандарт распространяется на:

1)    продукцию, предназначенную для потребления человеком и кормления животных:

2)    пробы окружающей среды, взятые из зоны производства пищевых продуктов и осуществления технологических операций с пищевыми продуктами:

3)    пробы окружающей среды из зоны производства сырья.

8 настоящем стандарте применены следующие условные обозначения:

•    stx: гены, ответственные за синтез Шига-токсина (используют также синоним — vtx):

•    Stx: Шига-токсин (используют также синоним — Vtx (веротоксин)]:

•    STEC: Escherichia coii, выделяющие Шига-токсин (используют также синоним—VTEC (Escherichia coii, выделяющие веротоксин)];

- еав: гены интимина.

2    Нормативные ссылки

Для применения настоящего стандарта необходимы следующие ссылочные стандарты. В случае недатированных ссылок применяют последнее издание ссылочного стандарта (включая все его изменения).

ISO 7218 Microbiology of food and animal feeding stuffs. General requirements and guidance for microbiological examinations (Микробиология пищевых продуктов и кормов для животных. Общие требования и рекомендации по микробиологическим исследованиям)

Издание официальное

1

ГОСТ ISO/TS 13136—2016

ISO 20838 Microbiology of food and animal feeding stuffs. Polymerase chain reaction (PCR) for the detection of food-borne pathogens. Requirements for amplification and detection for qualitative methods (Микробиология пищевых продуктов и кормов для животных. Полимеразная цепная реакция (ПЦР) для обнаружения патогенных микроорганизмов в пищевых продуктах. Требования к амплификации и детектированию для качественного анализа)

ISO 22174 Microbiology of food and animal feeding stuffs. Polymerase chain reaction (PCR) for the detection of food-borne pathogens. General requirements and definitions (Микробиология пищевых продуктов и кормов для животных. Полимеразная цепная реакция (ПЦР) для обнаружения патогенных микроорганизмов в пищевых продуктах. Общие требования и определения)

3    Термины и определения

В настоящем стандарте применены следующие термины с соответствующими определениями:

3.1    Escherichia coll, продуцирующие Шига-токсин; STEC [Shiga toxin-producing Escherichia coli (STEC)]: Штаммы E. coli. имеющие гены, ответственные за синтез Шига-токсина

3.2    Escherichia coll, продуцирующие Шига-токсин (STEC), вызывающие повреждение путем прикрепления бактерий и разрушения ими щеточной каймы эпителия клеток кишечника (Shiga toxin-producing Escherichia coli causing the attaching and effacing lesion. STEC causing the attaching and effacing lesion): Штаммы E. coli, имеющие гены, ответственные за синтез Шига-токсина и ген. ответственный за синтез иктимина (еае).

Примечание — Данная комбинация генов вирулентности часто бывает причиной наиболее тяжелых форм болезней, вызванных STEC.

3.3    Escherichia coli, продуцирующие Шига-токсин (STEC), серогруппы которых являются высоколатогенными (Shiga toxin-producing Escherichia coli belonging to highly pathogenic serogroups, STEC belonging to highly pathogenic serogroups): Штаммы E. cols, имеющие гены, ответственные за синтез Шига-токсина. ген. ответственный за синтез интимина {еае) и относящиеся к серогруппам 0157. 0111. 026. 0103 и 0145.

4    Сущность метода

4.1    Общие положения

Используемый метод состоит из следующих последовательных этапов:

a)    микробное обогащение:

b)    выделение нуклеиновых кислот (ДНК):

c)    выявление генов вирулентности;

d)    выявление генов, присутствующих в серогруппах:

e)    селекция из положительных проб.

Примечание — Блок-схема проведения исследования представлена на рисунке А.1.

4.2    Микробное обогащение

Бактерии STEC выявляют после увеличения их количества путем инкубирования анализируемой пробы в неселективной жидкой питательной среде, например:

a)    модифицированный триптон-соевый бульон (триптон-соееый бульон с добавлением соли желчных кислот № 3. концентрация которой — 1.5 г/дм3, и добавлением новобиоцина. концентрация которого — 16 мг/дм3)— mTSB+N;

b)    забуференная лептонная вода (BPW):

c)    модифицированный триптон-соевый бульон (триптон-соевый бульон с добавлением соли желчных кислот Ne 3. концентрация которой — 1.5 г/дм3, и добавлением акрифлавина. концентрация которою — 12 мг/дм3) — mTSB+A, для анализа молока и молочных продуктов.

mTSB используют при анализе проб, предположительно содержащих большие количества нецелевых микроорганизмов.

Новобиоцин и акрифлаеин подавляют рост грамположительных бактерий и способствуют росту грамотрицательных бактерий, в том числе STEC.

2

ГОСТ ISO/TS 13136—2016

BPW применяют для анализа проб, которые предположительно содержат подвергнутые стрессу целевые бактерии (например, пробы замороженных продуктов), чтобы реанимировать подвергнутые стрессу бактерии STEC. и предположительно содержащие меньшее количество нецелевых микроорга* низмов. чем свежие пробы.

Примечание — Добавление новобиоцина является спорным и было исследовано несколькими авторами. Было установлено, что минимагъная ингибирующая концентрация антибиотика для бактерий STEC. не относящихся к серогруппе 0157. ниже, чем для штаммов серогруплы 0157 (см. [5]). Добавление новобиоцина при обогащении в mTSB. когда концентрация новобиоцина является типичной (20 мг/дм3). как это установлено в (19]. приводило к подавлению роста приблизительно одной трети клеток штаммов бактерий, не относящихся к сврогрул-ле 0157 (см. [6]). что повышает риск ложно-отрицагегъных результатов.

4.3    Выделение нуклеиновых кислот (ДНК)

Нуклеиновые кислоты экстрагируют в соответствии с требованиями используемой системой ПЦР в режиме реального времени.

4.4    Выявление целевых генов

Очищенную ДНК используют для обнаружения следующих целевых генов:

•    основные гены вирулентности для STEC: генов six. кодирующих токсины Шига и еае-гена. кодирующего белок массой 90 еда — иктимин. участвующих в механизме адгезии, которая является характерным признаком штаммов STEC. вызывающих тяжелые заболевания. Гены six кодируют семейство токсинов, в том числе два основных типа: s!x1 и s!x2. Slx2 состоит из семи четко установленных вариантов — от slx2a до stx2g (см. [22]). Варианты генов slx2a. stx2b и stx2c. присутствующие в штаммах бактерий STEC. в числе генов, которые приведены в разделе 1, представляют собой целевые гены, кодирующие Шига-токсин. на которые распространяется настоящий стандарт.

8 базе данных GenBank генам, кодирующим данные варианты s(x2, присвоены следующие обозначения: slx2a: Х07865: slx2£>: L11078; s!x2c: М59432.

•    ген еае. кодирующий интимин;

•    гены для определения соответствующей серогрулпы: rfb£(0157). wb0/(O111). wzx(026). /1)р1(0145)и ivzx(O103).

4.5    Выявление

Выявление целевых генов проводят в соответствии с требованиями используемой системы ПЦР в режиме реального времени.

4.6    Селекция из положительных проб

Если есть подозрение, что в пробе присутствуют STEC. проводят селекцию микроорганизмов. В случае обнаружения по меньшей мере одной серогрулпы. которая описана в разделе 1. допускается проводить обогащение данной серогрулпы (например, методом иммуномагнитного разделения), после чего проводят посев на агар с триптоном, желчью и глюкуроновой кислотой (ТВХ) или на определенную селективную среду, если существует такая возможность (см. приложение F. примечания 2 и 3). Данную операцию проводят с целью облегчения отделения STEC от фоновой микрофлоры.

5 Разбавители, питательные среды и реактивы

В ходе проведения анализа, если не указано иное, используют реактивы только признанной аналитической степени чистоты и стерильную, дистиллированную, деминерализованную воду или воду эквивалентной чистоты.

5.1    Питательные среды

5.1.1    Модифицированный триптон-соевый бульон (mTSB)

5.1.1.1    Базовый состав и pH среды

Ферментативный перевар казеина —17 г;

Ферментативный перевар сои — 3 г:

0(+)-гпюкоза — 2.5 г;

Натрия хлорид — 5 г;

3

ГОСТ ISO/TS 13136—2016

Калий фосфорнокислый двухзамещенный (К2НР04) — 4 г;

Соли желчных кислот N9 3 — 1.5 г;

Дистиллированная вода — до 1000 см3: pH (7.4 ± 0.2) ед. pH.

Процедура приготовления среды следующая: компоненты сухой питательной среды растворяют в воде. Устанавливают pH на уровне (7.4 ± 0.2) ед. pH при температуре 25 *С и стерилизуют автоклавированием при температуре 121 °С в течение 15 мин.

5.1.1.2    Раствор новобиоцина Состав раствора:

Новобиоцин — 0,16 г:

Вода —10 см3.

Процедура приготовления раствора следующая: новобиоцин растворяют в воде и стерилизуют путем мембранной фильтрации с помощью фильтров с размерами пор 0.22 мкм или 0,45 мкм.

Раствор готовят в день его использования.

5.1.1.3    Раствор акрифлавина Состав раствора:

Акрифлавин — 0,12 п

Вода —10 см3.

Процедура приготовления раствора следующая: акрифлавин растворяют в воде и стерилизуют путем мембранной фильтрации с помощью фильтров с размерами пор 0.22 мкм или 0,45 мкм.

Раствор готовят в день его использования.

5.1.1.4    Приготовление готовой питательной среды

Непосредственно перед использованием 1 см3 раствора новобиоцина (см. 5.1.1.2) или раствора акрифлавина добавляют (см. 5.1.1.3) к 1000 см3 охлажденного бульона mTSB (см. 5.1.1.1).

Конечная концентрация новобиоцина в mTSB должна быть 16 мг/дм3.

Конечная концентрация акрифлавина в mTSB должна быть 12 мг/дм3.

5.1.2    Забуференная пептонная вода (BPW)

Состав и pH 8PW:

Пептоны —10 г:

Натрия хлорид — 5.0 г.

Натрий фосфорнокислый двухзамещенный двенадцативодный (NajHPO* -12 Н20) — 3.5 г:

Калий фосфорнокислый однозамещенный (КН2Р04)— 1.5 г:

Вода — до 1000 см3; pH (7.0 ± 0.2) ед. pH.

Процедура приготовления BPW следующая: компоненты сухой питательной среды растворяют в воде. Устанавливают pH на уровне (7.0 ± 0.2) ед- pH при температуре 25 °С и стерилизуют автоклавированием при температуре 121 *С в течение 15 мин.

5.2    Реактивы для экстракции нуклеиновых кислот (ДНК)

Реактивы, используемые для экстракции нуклеиновых кислот, не приведены в настоящем пункте, поскольку они могут быть разными в зависимости от используемого метода (см. 9.3).

5.3    Реактивы, используемые при проведении ПЦР

Используют реактивы, приведенные в ISO 20836.

5.3.1    Олигонуклеотиды (праймеры) и зонды обнаружения

Праймеры и зонды для обнаружения конкретных целевых последовательностей генов стандартными методами ПЦР и методами ПЦР в режиме реального времени приведены в приложениях С и Е.

6 Оборудование и лабораторная посуда

Используют обычное оборудование, необходимое для микробиологической лаборатории (см. ISO 7218) и. в частности, следующее.

6.1    Баня водяная или нагревательный блок, способные поддерживать температуру до 100 вС.

6.2    Термостат (см. ISO 7218). способный поддерживать температуру на уровне (37 ± 1) *С.

4

ГОСТ ISO/TS 13136—2016

6.3    Оборудование для выделения нуклеиновых кислот (ДНК), выбираемое в зависимости от но пользуемого метода, при необходимости.

6.4    Пипетки вместимостью от 1 мм3 до 100 мм3 (см. [16]).

6.5    Тонкостенные микропробирки для проведения ПЦР в режиме реального времени, вместимостью 0.2 и 0.5 см3, многолуночные микропланшеты для проведения ПЦР или другая подходящая прозрачная одноразовая пластиковая лабораторная посуда.

6.6    Амплификатор. некоторые торговые марки которого доступны на рынке и который выбирают в зависимости от методов, используемых в лаборатории.

6.7    Прибор для обнаружения продуктов ПЦР

Прибор для проведения ПЦР в режиме реального времени позволяет обнаружить световое излучение. которое появляется после ПЦР-анализа с использованием 5'-нуклеазы.

6.8    Перистальтический смеситель со стерильными пакетами, в некоторых случаях оснащенный прибором регулирования скорости и времени.

7    Отбор проб

Отбор проб не является частью метода, установленного в настоящем стандарте. Информация об отборе проб приведена в определенных стандартах на конкретную продукцию, а также в определенных нормативных документах. В случае, когда стандарт, где приведена информация об отборе проб конкретного вида продукции, отсутствует, рекомендуется, чтобы заинтересованные стороны пришли к соглашению по данному вопросу.

8    лабораторию необходимо доставить представительную пробу, которая не была повреждена или изменена в процессе транспортирования или хранения.

8    Подготовка пробы для испытания

Испытуемую пробу подготавливают в соответствии с конкретным стандартом на конкретный вид продукции. В случае, когда стандарт, где приведена информация о подготовке проб конкретного вида продукции, отсутствует, рекомендуется, чтобы заинтересованные стороны пришли к соглашению по данному вопросу.

9    Методика проведения испытания

9.1    Приготовление анализируемой пробы и исходной суспензии

9.1.1    Общие положения

Используют количество среды для обогащения, необходимое для получения окончательного разведения 10'1 первоначальной анализируемой пробы.

9.1.2    Приготовление анализируемых проб с предположительно высоким уровнем фоновой микрофлоры

В случае твердых проб пищевой продукции порцию анализируемой пробы (х г) в стерильных условиях переносят в мешок перистальтического смесителя, содержащий 9х см3 бульона mTSB. в который добавлен новобиоцин или акрифлавин (см. 5.1.1.4). Рекомендуется использовать мешки, оснащенные фильтрами.

Полученную смесь гомогенизируют в смесителе (см. 6.8; см. ISO 7218).

8 случае жидких проб пищевой продукции порцию анализируемой пробы (х см3) в стерильных условиях переносят в мешок перистальтического смесителя, содержащий 9х см3 бульона mTSB для обогащения, в который добавлен новобиоцин или акрифлавин (см. 5.1.1.4).

9.1.3    Приготовление анализируемых проб, предположительно содержащих целевые бактерии, подвергнутые стрессу

Замороженные пробы размораживают при комнатной температуре, затем порцию анализируемой пробы (х г или х см3) переносят в мешок перистальтического смесителя или пробирку, содержащую 9х см3 BPW (см. 5.1.2) и далее действуют, как это описано выше.

5

ГОСТ ISO/TS 13136—2016

9.2 Обогащение

9.2.1    Инкубирование

Содержимое мешка перистальтического смесителя, пробирки или флакона (см. 9.1.2) инкубируют при температуре (37 ± 1) вС в течение 18—24 ч.

9.2.2    Контроль над процессом (для ПЦР в реальном времени)

Контроль над процессом выполняют в соответствии с положениями, изложенными в ISO 22174.

Руководство по внутреннему контролю амплификации (1АС) и контролю над процессом приведены в приложении D и С.3.8.

9.3    Выделение нуклеиновых кислот (ДНК)

Методики экстракции нуклеиновых кислот (ДНК) должны соответствовать методикам, применяемым в отношении грамотрицательных бактерий. Полный перечень методов приведен в [10]. Кроме того, допускается использовать имеющиеся в продаже наборы в соответствии с инструкциями изготовителя.

9.4    ПЦР-амплификация (для ПЦР в режиме реального времени)

9.4.1    Общие положения

Используемый процесс ПЦР-амплификации применяют при проведении ПЦР в режиме реальною времени.

Необходимо выполнять все требования к ПЦР-амплификации. которые изложены в ISO 20838.

Информация о праймерах и зондах для обнаружения, использующихся при проведении ПЦР в режиме реального времени, приведена в приложении Е.

9.4.2    Обнаружение продуктов ПЦР

Прибор для обнаружения продуктов ПЦР улавливает световое излучение, как только оно возникает в процессе амплификации.

9.4.3    Интерпретация результатов ПЦР-анализа

Результаты, полученные при проведении ПЦР. в том числе контрольные, информация о которых приведена в ISO 22174 и в приложении О. обрабатывается программным обеспечением прибора для амплификации. В ходе процесса амплификации программное обеспечение прибора контролирует ПЦР-амплификацию с использованием 5'-нуклеаэы посредством анализа интенсивности флуоресценции ре-портерного красителя для каждой пробы, R„. ARn — это разность Rn и контрольного значения интенсивности флуоресценции репортерного красителя, определенною в результате первых нескольких циклов. Значение порогового цикла. С(. определяют как номер цикла, при котором значение интенсивности флуоресценции Д/?л данной пробы превышает установленное значение порогового цикла.

В случае, если были получены сомнительные результаты, проводят проверку кривых значений излучения на графике. Для проб, демонстрирующих положительный результат, характерна кривая, на которой явно выражено усиление флуоресценции, начиная с количества циклов, значения которых соответствуют С(.

Если полученные значения приводят к непредвиденным результатам, то анализ повторяют.

Данный метод является последовательным (см. блок-схему на рисунке А.1). Стадии данною метода следующие:

-    стадия 1: обнаружение генов, кодирующих Шига-токсин и гена, кодирующего интимин (см. ПЦР А. приведено в приложении Е; данную процедуру можно также провести с помощью дуплексной ПЦР);

• стадия 2 а): проведение испытания проб, содержащих бактерии с генами stx и еае гена, на молекулярное серогруппироеание (см. ПЦР Б. приведено в приложении Е);

-    стадия 2 б): выделение штаммов бактерий из проб, бактерии в которых содержат гены, кодирующие Шига-токсин; допускается использовать метод обогащения конкретных серогрупп (например, им-муномагнитное разделение) для повышения эффективности отделения клеток бактерий STEC от проб, содержащих хотя бы одну из серогрупп. приведенных в разделе 1 (см. 9.5 и рисунок В.1).

9.5    Выделение штаммов

Выделение штаммов бактерий STEC необходимо для подтверждения того, что положительный результат ПЦР-анализа получен из ДНК именно этих живых бактериальных клеток.

В случае наличия одного из генов, характерных для серогрупп. приведенных в разделе 1. допускается проведение обогащения конкретной серогруппы с целью повышения эффективности стадии

6

ГОСТ ISO/TS 13136—2016

выделения, после чего проводят прямой посев на подходящую плотную среду и скрининг колоний на наличие генов вирулентности.

Для подтверждения наличия генов вирулентности в выделенных колониях используют протоколы, описывающие проведение стандартной ПЦР. ЛЦР в режиме реального времени (см. приложения С и Е). а также протокол проведения любого другого вида ПЦР. которая аналогична ранее указанным видам ПЦР.

Блок-схема выделения бактерий STEC приведена на рисунке В.1. а методика данной процедуры — в приложении F.

10    Интерпретация результатов

a)    Пробы, не содержащие бактерий с sfx-геном: в х г или х см3 анализируемой пробы STEC не обнаружены (см. ISO 7218).

При отсутствии генов sfx, проведение испытания прекращают и не проводят дальнейшего определения наличия гена еае и генов, присутствующих в серогруппах. приведенных в разделе 1.

6 случае, когда не удалось провести выделение бактерий из проб, положительных на наличие sfx-генов. тогда:

b)    Пробы, положительные на наличие sfx-генов: в х г или х см3 анализируемой пробы предположительно обнаружены STEC.

c)    Пробы, положительные на наличие генов sfx и еае: в х г или х см3 анализируемой пробы предположительно обнаружены STEC. вызывающие повреждение путем прикрепления бактерий и разрушения ими щеточной каймы эпителия клеток кишечника.

d)    Пробы, положительные на наличие генов sfx и еае. а также генов, характерных для одной из серогрупп. приведенных в разделе 1: в х г или х см3 анализируемой пробы предположительно обнаружена серогрулпа STEC XX11.

8 случае, когда удалось провести выделение и подтверждение бактерий из проб, положительных на наличие sfx-генов. тогда:

e)    Выделенные штаммы Е. coti, положительные на наличие stx-гена: наличие STEC в х г или х сманализируемой пробы.

0 Выделенные штаммы Е. со//, положительные на наличие генов sfx и еае: в х г или х см3 анализируемой пробы обнаружены STEC. вызывающие повреждение путем прикрепления бактерий и разрушения ими щеточной каймы эпителия клеток кишечника.

д) Выделенные штаммы Е. Со//, положительные на наличие генов stx и еае, а также генов, характерных для одной из серогрупп. приведенных в разделе 1: обнаружена серогрулпа STEC XX21 в х г или х см3 анализируемой пробы.

11    Эксплуатационные характеристики

11.1    Метод ПЦР в режиме реального времени, установленный в настоящем стандарте, прошел процедуру валидационного исследования в соответствии с требованиями, приведенными в {17].

11.2    Чувствительность и предел обнаружения бактерий методом ПЦР в режиме реального времени были определены с помощью разведений плазмид, содержащих клонированные гены, кодирующие специализированную экспрессию (см. [8]). Результаты данного исследования приведены в таблице 1.

Таблица 1 — Чувствительность и предал обнаружения S'-нухпеаэы с помощью ПЦР для некоторых генов, рассматриваемых в настоящем стандарте (см. [8]).

Целевой ген

Предел обнаружения, количество копий >а реакцию

Эффективность. %

s!x\

5

94.7

51x2

5

94.0

rfbE

1

94.2

Ч XX — это серогрулпа с искомыми генами.

2> Серогрупла, выделенный штамм которой используют для обнаружения присутствия соответствующих генов или при помощи фенотипичного определения.

7

ГОСТ ISO/TS 13136—2016

Окончание таблицы 1

Целевой геи

Предел обнаружения, количество копий за реакцию

Эффективность, %

wtxtt

5

94.0

wzx

5

97.7

Apl

5

99.6

Дополнительное исследование (см. (17]) проводилось с целью определения эффективности пред* латаемых подходов к проведению ПЦР в режиме реального времени при анализе смешанных культур серогрупп STEC. приведенных в области применения настоящего стандарта: при этом предполагается использовать лабораторный штамм К*12 (С600). Результаты исследования приведены в таблице 2.

Таблица 2 — Обнаружение малого числа бактерий STEC в смешанных культурах (см. (1S])

Серотип

STEC

KOEi'cm3

Предел обнаружения

в(х1/Ых2

еэс

НЬЕ

(0157)

wbtfl

(0111)

WZX

(0105)

Лр1

(0145)

КС

<Н7)

wtx

(026)

2—3

28—31

31—32

31—33

02в:Н11

10—20

25—27

28—29

29

2—3

29—30

31—32

32—33

О103:Н2

10—20

26—27

29—30

29—31

2—3

26—27

30—31

30—31

01ЩН8)

10—20

24—25

29—30

27—28

2—3

32—33

31—32

31—34

0145:(Н28)

10—20

30—32

29—31

30

2—3

29—30

29—31

31—32

33—38

0157:Н7

10—20

26—28

26—29

29—31

31—33

11.3 Исследование включало изучение комплекта из пяти имитационных каркасных тампонов (влажных губок), содержащих целевые микроорганизмы, в том числе серогруппы STEC 0157 и 026. а также фоновую микрофлору (см. таблицу 3). При выборе имитационных каркасных тампонов в качестве матрицы для анализа руководствовались основными положениями (см. [19]).

Таблица 3 — Состав проб, исследованных в ходе межлабораторного испытания

Значения приведены в КОЕ/сма

Загрязняющая микрофлора и гены

Проба Л

Проба В

Проба С

Проба 0

Проба Е

STEC 0157 sTxl, six2, еае

2

2-103

20

0

0

STEC 026 sJxl. еае

0

40

4-103

40

0

8

ГОСТ ISO/TS 13136—2016

Окончание таблицы 3

Загрязняющая мифофлора и гены

Проба А

Проба В

Проба С

Проба 0

Проба Е

Е. coli

102

102

102

102

102

К. pneumoniae

2-102

2-102

2-102

2-102

2-10*

S. faecalis

5-102

5-102

5-102

5-102

5-102

8 исследовании по определению Е. соИ принимали участие 14 национальных референс-лабора-торий (NRL). В ходе оценки эффективности данного метода при определении серогрупп STEC, отличных от серогруппы 0157 (серогруппы 026) были получены следующие значения:

•    Чувствительность (Se) — 100 % (при доверительном интервале 95 %. 96,97 % — 100 %);

•    Специфичность (Sp) — 99.62 % (при доверительном интервале 95 %. 97.5 % — 100 %). Результаты анализа, полученные в каждой национальной референс-лаборатории. принимавшей

участие в исследовании, приведены в таблице 4.

Таблица 4 — Результаты обнаружения генов вирулентности и генов серогрупп в культурах после их обогащения методом ПЦР в режиме реального времени (часть метода анализа, проводившегося в ходе третьего совместного межпа бора торного испытания)

9

ГОСТ ISO/TS 13136—2016

Национальные реферейс-лаборатории получили запрос, чтобы они также проводили выделение серогрупп STEC. отличных от серогруппы 0157. которыми загрязнены пробы. Результаты данной про* цедуры приведены в таблице 5.

Таблица 5 — Выделение бактерий серогруппы STEC 026 из культур после их обогащения методом ПЦР в режиме реального времени {Подтверждение позитивных культур путем выделения инфекционных штамме», проводившегося в ходе третьего совместного межлаборзторного испытания)

вид испытания

Проба

Истинное

значение

Лаборатории, принимавшие участие в исследовании

".

Л2

Л*

Л7

Л*

я9

Л«

Л.5

Л«

Л17

Л2,

Л»

Л»

Выделение серогругеты 026

В

+

+

+

+

+

+

+

+

+

+

+

+

+

С

+

+

+

+

+

+

+

+

+

+

+

+

+

D

+

+

+

+

+

+

+

+

+

+

+

+

+

Отчет, включающий всесторонний анализ результатов, полученных в ходе третьего совместного межлабораторного испытания, имеется в открытом доступе (см. [9]).

Расширенная неопределенность U, характеризующая концентрацию бактерий в инокуляте, равна 0.22-!од10 КОЕУсм3 для штаммов Е. со// (соответствующая информация приведена в (20]).

10

ГОСТ ISO/TS 13136—2016

Приложение А

(обязательное)

Блок-схема процедуры проведения анализа

Анализируемая проба, х г или х сы*

I

9* см3 тТ$В • ноеобиоцин (или акрифлааин) или BPW

I

Обогащение в течение 16-24 ч при температуре (37 ± 1) *С

1

Отбор анализируемой пробы (1 см3) из раствора культуры, очистка ДНК и обнаружение генов six и еае

Положительный результат наличия генов stx и еае.

Испытание на наличие генов в бактериях серогрупп. выделение чистого штамма

(см. приложение в)

I \

Положительный    Отрицате/ъмый

результат наличия    результат определения

гена stx    иапи-мя гена stx

Выделение чистого штамма

(см приложение в)

Регистрация результата Регистрация результата Регистрация результата

Рисунок А.1 — Блок-схема процедуры проведения анализа

11

ГОСТ ISO/TS 13136—2016

Приложение В

(обязательное)

Блок>схема процедуры выделения и подтверждения1)

В.1 В случае, если проба положительная для одного из генов серогрупп, на которые распространяется ранный метод, в целях повышения эффективности выделения бактерий допускается проворить обогащение бактерий определенных серогрупп.

Обогащение в жидкой питательной среде или путем штрихового посева на поверхности подходящей плотной среды.

Инкубирование в течение 18-24 ч при температуре (37 ± 1)вС

I

Отбор не более 50 колоний Е <хЛ с характерной морфологией Посев на питательный агар (отрельиых колоний) и (жжупяция колоний в воду (колоний, объединенных по 10 штук).

Проведение ПЦР-анапиза на обнаружение генов s(x и еэе в изолированных или объединенных колониях

I

Если колония являете» положительной на наличие генов, выявленных при анализе, переходят к следующей нижеуказанной процедуре Если слившиеся колонии также демонстрируют положительный результат, инкубируют колонии на питательном агаре.

Проводят испытание отдельных колоний, выполняя операции со слившимися колониями.

как это указано выше

I

Устанавливают принадлежность положительных колоний к виду Е coh и определяют серогруплу в случае, если проба была положительной, что было установлено в ходе проведения ПЦР для обнаружения конкретной серогруппы (например, при помощи ПЦР

или реакции агглютинации)

I

Штамм отправляют в рефереис-лаборэторню для более подробного определения характеристик (данная процедура не является обязательной)

I

Регистрация результата

Рисунок В.1 — Блок-схема процедуры выделения чгстых штаммов и подтверждения результата

12

П См. приложение F.

ГОСТ ISO/TS 13136—2016

Приложение С

(справочное)

Идентификация Escherichia со//, продуцирующих Шига-токсин (STEC), путем выявления генов вирулентности мультиплексной ПЦР«амплификацией и обнаружение продуктов ПЦР путем

электрофореза в агарозном геле

С.1 Общие положения

STEC являются штаммами Escherichia coir, которые позволяют внедряться лизогенным бактериофагам, имеющим гены, кодирующие синтез Шига-токсинов (см. (12]). Метод, описанный в настоящем приложении, позволяет обнаружить с помощью мультиплексной ПЦР наличие STX-кодирующих генов в культурах Е. cob, принадлежащих к STEC. Проводят также определение наличия гена еае. поскольку он присутствует в штаммах STEC, вызывающих тяжелые заболевания человека.

Использование пар олигонуклеотидных праймеров s(x1F/sfx1/?M sU2F/stx2R (см. (11]). позволяет обнаружить гены sJx1 и stx2 соответственно. stx2F/six2R позволяет обнаружить все варианты гена six2. кроме slx2/. Тем не менее, это не является существенным для здоровья населения, так как данный вид гена в основном присутствует в STEC. выделенных из птиц (см. (20]). Праймеры, используемые для обнаружения гена еае (см. (11]). способны распознавать все описзшые в публикациях полиморфные варианты этого гена.

Примечание — Метод, приведенный в настоящем приложении, используют в отношении чистых бактериальных культур только для подтверждения принадлежности выделенных штаммов.

С.2 Сокращения

О.П.: отдельная проба.

С.З Порядок проведения метода

С.3.1 Сущность метода

Метод основан на ПЦР-ампгыфикации специфических областей ДНК из ДНК-магрицы. с олигонуклеотидами, вызывая начало реакции ПЦР

Обнаружение slxl. sfx2 и еае генов проводят с помощью мультиплексной ПЦР с использованием специфических праймеров (см. таблицу С.1). Метод состоит из следующих этапов.

•    пробоподготоека;

•    проведение ПЦР;

•    визуализация продуктов ПЦР с помощью горизонтального электрофореза в агарозном геле.

С.3.2 Пробоподготоека

Полученные бактериальные культуры на твердых питательных средах, например на трипгон-соееом агаре (TSA). обрабатывают следующим образом:

•    отбирают одну колонию стерильной петлей, захватывающей объем 1 мм3:

•    пробоподготоека осуществляется путем суспендирования бактерий в 100 мм3 стерилизованной воды, деионизированной путем фильтрации через фильтр milliQ1> с диаметром пор 0,22 мкм. с последующим кипячением в течение 10 мин.

С.3.3 Проведение ПЦР

Для каждой пробы готовится отдельно 50 мм3 реакционной смеси, состоящей из реакционного буфера. MgCI2 в концентрации 1,2 ммоль/дм3. дезоксинуклиотидфоофагаз (dNTP) 8 концентрации 0,2 ммоль/дм3 каждой. 50 пмоль каждого праймера, 2 единицы Taq-полимерезы и 10 мм3 ДНК-матрицы.

Объем реагентов зависит от конечного объема реакцюг. При проведении ПЦР-реакций используют деионизованную воду, указанную в С.3.2.

Проведение каждой ПЦР включает в себя положительный и два отрицагегъных контроля. ДНК-матрицу для положительного контроля получают из штамма Е.соЬ. гарантированно содержащего гены вирулентности, в то время как отрицательным контролем служит ДНК-иэолят от непатогенных штаммов Е.соЬ (не несущих в своем геноме генов вирулентности), вторым отрицатегъным контролем служит реакционная смесь без добавления матричной ДНК.

Проведение реакции происходит в амплификаторе с запрограммированным тепловым профилем (см. (11] и таблицу С.1).

С.3.4 Электрофорез в агарозном геле

Готовят раствор агарозы в концентрации 20 г/дм3 в однократном трис/борат/ЭДТА (ТЕЗЕ) или трис/этилацегзт/ ЭДТА (ТАЕ) буфере. Заполняют каждую лунку затвердевшего агарозного геля продуктами ПЦР в объеме 15 мм3.

MiKiO является торговым наименованием продукции, поставляемой Mtllipore Corporation. Данная информация приведена для удобства пользователей настоящим стандартом и не является рекламой ISO данной продукции. Допускается применение аналогичных продуктов, если доказано, что они обеспечивают получение сопоставимых результатов.

13

ГОСТ ISO/TS 13136—2016

смешанных с красителем. Электрофорез проводят в однократном буфере (ТВЕ или ТАЕ) при постоятом напряжении (100 V). Использование маркера молекулярного веса позволяет определить необходимые молекулярные массы полученных ампликоное (см. таблицу С.1).

Примечание — Правильное определение полос в агарозном геле, после проведения электрофореза, является важным моментом в оценке наличия генов вирулентности. Убедитесь, что полосы, полученные на положительном контроле, точно соответствуют определенной молекулярной массе.

В агарозный гель необходимо добавить бромистый этидий для визуализации продуктов ПЦР. При аоздей-ств1Ы на данный реактив ультрафиолетового излучения он флуоресцирует красно-оранжевым цветом. Конечная концентрация бромистого этидия составляет 0,5 мкг/см3 при добавлении перед заливкой агарозного геля в планшет для гель-электрофореза.

В качестве альтернативы допускается окрашивание агарозного геля после электрофореза в водном растворе этидий бромида концентрацией 0.5 мкг/см3.

С.3.5 Оборудование

Используют обычное оборудование, необходимое для микробиологической лаборатории (см. ISO 7218) и. в частности, следующее.

С.3.5.1 Ламинарный бокс для ПЦР

С.3.5.2 Дозатор, вместимостью 1 см3 стерильный.

С.3.5.3 Стерильные бактериологические петли.

С.3.5.4 Флаконы из боросиликатного стекла, вместимостью 500 см3.

С.3.5.5 Цилиндры из боросиликатного стекла, вместимостью 500 см3.

С.3.5.6 Цилиндры из боросиликатного стекла, вместимостью 1 дм3.

С.3.5.7 Термостат, способный поддерживать температуру на уровне (37 11) "С.

С.3.5.8 Технические настогъные весы.

С.3.5.9 Автоклав.

С.3.10 Устройство для раскапывания.

С.3.5.11 Микропипетки.

С.3.5.12 Наконечники для микропипеток, стерильные.

С.3.5.13 Микропробирки, вместимостью 1,5 см3.

С.3.5.14 Микропробирки для ПЦР. вместимостью 0,2 или 0.5 см3.

С.3.5.15 Амплификатор.

С.3.5.16 Магнитная мешалка.

С.3.5.17 Магнитное устройство для перемешивания.

С.3.5.18 Деионизатор воды.

С.3.5.19 Камера для электрофореза.

С.3.5.20 УФ-трансиллюминатор.

С.3.5.21 Льдогенератор.

С.3.5.22 Микроволновая печь.

С.3.6 Реактивы и среды

В ходе анализа, если не указано иное, используются реактивы ч. д. а. и стерильная дистиллированная или деминерализованная вода или вода эквивалентной чистоты.

С.3.6.1 Агар микробиологический.

С.3.6.2 Раствор dNTP.

С.З.в.З Синтетические олигонуклеотидные праймеры.

С.3.6.4 Taq ДНК-лолимераза и десятпсратный реакционный буфер с или без MgCl2

С.3.6.5 Буфер для электрофореза.

С.3.6.6 Маркер молекулярного веса ДНК.

С.3.6.7 Краситель для внесения в продукты ПЦР

С.3.6.8 Агароза.

С.3.6.9 Раствор этидия бромида или другой краситель ДНК в геле.

С.3.7 Безопасность и защитные устройства

Некоторые штаммы STEC могут инфицировать людей при очень низкой инфекционной дозе и могут вызвать серьезные заболевания. Были зарегистрированы случаи инфицирования в лаборатории. Поэтому, работая с STEC. требуются профессиональные навыки работы в лаборатории и использование защитных устройств. Этидия бромид является мутагенным и токсичным реагентом, поэтому им необходимо пользоваться соблюдая технику безопасности и применяя средства защиты (лабораторный халат и латексные перчатки). Ультрафиолетовое излучение может привести к повреждению глаз, в связи с этим является обязательным использование полимегилмета-крипатных щитов и защитных очков.

С.3.8 Штаммы микроорганизмов и контроли для ПЦР

В качестве положительного контроля используют STEC штаммы микроорганизмов несущие в своем геноме гены s/x1. stx2 и гены еае. Примером может служить эталонный штамм E.coli 0157 EOL933 (WDCM 00188. см. [12]. (13]).

14

ГОСТ ISO/TS 13136—2016

В качестве отрицательного контроля следует использовать любой штамм E.coS К12, например. MG1655.

Конгроли для ПЦР получают, как указано в С.3.2. Конт роли могут быть подготовлены заранее и хранится в аликвотах по 10 мм3, готовых к использованию при температуре минус 20 *С в течение 8 мес.

С.3.9 Интерпретация результатов

Пробы, показывающие фрагменты амплификации ожидаемого размера {см. С.3.4 и в таблице С.1), считаются положительными на наличие в своем геноме целевых генов.

Необходимо включать положительные и отрицательные конгроли в каждой реакции, давая положительные и отрицательные результаты, соответственно. Если контроли дают неоднозначные результаты, необходимо повторить всю процедуру анализа.

Проверка правильности эмпликона с помощью прямого секвенироеания или других подходящих способов можно считать излишним, так как этот метод предназначен для подтверждения штаммов, выделенных и уже подвергшихся ПЦР-анализу в режиме реального времени.

Подтверждение амплихоное (например, путем прямого секвенироеания или путем анализа эндонуклеазы рестрикции) необходимо проводить при получении неоднозначных результатов.

Таблице C.t — Олигонуклиогидные праймеры, получаемые фрагменты ожидаемого размера

Целевой геи

Название

праймеров (см. (11))

Последовательность

праймерое

Размер

амплихоное,

bp

eaeAF

GAC CCG GCA CAA GCA TAA GC

384

ФСГС7

eaeAR

CCA CCT GCA GCA АСА AGA GG

slxl F

ATAAATCGC CATTCG TTGACTAC

4 PA

SfXl

stx1R

AGA ACG CCC ACT GAG АТС АТС

10U

six2 (группа)

stx2F

GGC ACT GTC TGA AAC TGC TCC

ORC

stx2R

TCG CCA GTT АТС TGA CAT TCTG

Параметры амплификации (см. (11]}: 35 циклов ПЦР. каждый из которых включает 1 мин денатурации при температуре 95 *С; 2 мин отжига при температуре 65 *С в течение первых 10 циклов, уменьшая температуру до 60 *С с 11 до 15 цикла (1 “С за цикл) и 1.5 мин относигегьного удлинения при температуре 72 *С. увеличивая до 2.5 мин с 25 до 35 цикле.

15

ГОСТ ISO/TS 13136—2016

Приложение D

(справочное)

Внутренний контроль амплификации

Три различных внутренних контроля элементов амплификации (lACs) могут быть использованы в ПЦР в режиме реального времени:

•    TaqMan®1) представляет собой внутренний положительный контроль. Это комплект реагентов, включающий в себя все необходимые реагенты (праймеры. Vic™*). IAC ДНК-мишекь и стоп-раствор). IAC ДНК-мишень требует разбавления в 10 раз. для достижения количества копий примерно для 100 ПЦР-реакции. Размер образующегося ПЦР продукта неизвестен.

•    Использование формулы pUC 19 на основе внутреннего контроля амплификации (АС (27]. Приблизительно 100 копий целевой ДНК (PUC 19) следует использовать в реакции ПЦР. Размер образующегося ПЦР продукта IAC составляет 119 Ьр.

•    Рекомбинантную плазмиду (имеющую название Piac-STEC) можно использовать в конкретных анализах stx с помощью ПЦР в режиме реального времени. Этот элемент (АС содержит следующий ДНК-фрагмент. клонированный в позицию EcoRi плазмиды pUC19:

5ATTTTTGTTACTGTGACAGCTGAAGCTTTACGTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTAT AGATGTTGATCTTACATTGAACTGGGGAATT-3' (жирным шрифтом выделены прямой и обратный stxVstx2 праймеры. связывающие сайты последовательности: подчеркнутая последовательность: (AC-зонд сайт связывания).

IAC может быть усилен генами stx, используя те же праймеры, для six генов (см. приложение Е). с геми же условиями и в той же ПЦР-пробирке (14]. Он обнаруживает специфическую ДНК в пробе (5‘ |Red640]-CAAGGCGACAAGGTGCTGATGCCG-(BHQ2] 3'). включенного в смесь ПЦР в концентрации, идентичной что и для зондов ДНК генов stx1 и slx2 (как помечены (флюоресцином] и [ВН01] на их 5'- и З’-концах соответственно). В обшей сложности 64 копий IAC следует использовать в реакции ПЦР. Продукт ПЦР МАК96 парных оснований. Произ-водигегъносгь в результате s/x-IAC ПЦР в режиме реального времет было показано с помощью искусственно и. естественно загрязненных проб пищевых продуктов (см. (5]).

Вторая и третья системы также могут быть использованы в качестве контроля экстракции путем добавления 100 копий плазм еды pUC 19 или plAC-STEC в пробу перед стадией очасгхи ДНК.

*) TaqMan и Vic являются торговыми наименованиями продукции, поставляемой Applied Biosystems. Данная информация приведена для удобства пользователей настоящим стандартом и не является рекламой ISO данной продукции. Допускается применение аналогичных продуктов, если доказано, что они обеспечивают получение сопоставимых результатов.

16

ГОСТ ISO/TS 13136—2016

Приложение Е

(справочное)

Праймеры и зонды для ПЦР-анализа

Описанный протокол ПЦР в режиме реального времени основан на использовании следующих праймеров и зондов, которые должны рассматриваться в качестве контрольных реактивов. Тем не менее, другие методы, включающие использование различных праймеров и зондов, могут быть использованы при условии, что они были признаны эквивалентными тем. которые указаны в таблицах Е.1 и Е.2 в соответствии с (17).

Е.1 Праймеры и зонды

Последовательности праймеров и зондов, представленные в таблицах ЕЛ и Е.2. используют для:

•    выявления генов stx и еае с помощью ПЦР в режиме реального времени (ПЦР А):

•    выявления генов, которые содержат определенные еврогруппы, с помощью ПЦР в режиме реального времени (ПЦР Б).

В таблицах Е.1 и Е.2 не указаны вид репортера и вид флуорофора. так как это во многом зависит от оборудования для ПЦР в режиме реального времени, используемого в каждой конфетной лаборатории.

Таблица ЕЛ — Праймеры и зонды, используемые для б'-нуклеаэой ПЦР

Целевой

геи

Прямой праймер, обратный праймер и последовательность зондов (5‘—З'|в

Размер

ампликона

bp

Ломпиза* имя а геноме

Порядковый номер в базе GenBank

5(Х1

ТТТ GTY ACT GTS АСА GCW GAA GCY ТТА CG

878-906

[31

ССС CAG ТТС ARW GTR AGR ТСМ ACR ТС

131

983-1008

М16625

Зонд — CTG GAT GAT СТС AGT GGG CGT ТСТ TAT GTAA

941-971

stx2b

(3)

ТТТ GTY ACT GTS АСА GCW GAA GCY TTA CG

785-813

CCC CAG TTC ARW GTR AGR TCM ACR TC

128

887-912

Х07865

Зонд — TCG TCA GGC ACT GTC TGA AAC TGC TCC

838-864

еае

12)

CAT TGA TCA GGA TTT TTC TGG TGA ТА

899-924

CTC ATG CGG AAA TAG CCG TTA

102

1000-979

Z11541

Зонд — АТА GTC TCG CCA GTA TTC GCC ACC AAT ACC

966-936

* В последовательности Y — (С. Т). S — (С, G). W — (А. Т). R —

(A. G). M — (A, C).

ь Эго сочетание праймер/зонд распознает все варианты stx2. хроме slx2f.

Таблица Е.2 — Праймеры и зонды используемые для усиления антиген-специфических генов при проведении ПЦР-анализа с использованием 5‘-нуклеазы

Целевой геи {серо группы)

Прямой праймер, обратный праймер и последовательность зондов (5‘—3')

Размер

аыппикоиа

bp

ЛокапИ’ эация в геноме

Порядковый номер в базе GenBank

rfbE (0157) (3]

ТТТ САС ACT TAT TGG ATG GTC TCAA

348-372

CGA TGA GTT TAT CTG CAA GGT GAT

88

412-435

AF163329

Зонд — AGG ACC GCA GAG GAA AGA GAG GAA TTA AGG

381-410

wMf(OIH)

(3]

CGA GGC AAC АСА TTA TAT AGT GCT TT

3464-3489

TTT TTG AAT AGT TAT GAA CAT CTT GTT TAGC

146

3579-3609

AF078736

Зонд — TTG AAT CTC CCA GAT GAT CAA CAT CGT GAA

3519-3548

17

ГОСТ ISO/TS 13136—2016

Окончание таблицы Е.2

Целевой ген (серо* руты)

Прямой праймер, обратный праймер и последовательность зондов (5*—3')

Размер

ампликоиа

Ьр

Локализация в геноме

Порядковый номер в базе GenSank

WZX (026)

13]

CGC GAC GGC AGA GAA ААТТ

5648-5666

AGC AGG СТТ ТТА TAT ТСТ CCA ACT ТТ

135

5757-5782

AF5290801

Зонд —СС CGTTAA АТС ААТ ACT ATT ТСА CGAGGT TGA

5692-5724

Лр1(0145)

[3]

CGA ТАА ТАТ ТТА ССС САС CAG ТАС AG

1383-1408

СС GCC GCA АТС СТТ

132

1500-1514

AF531429

Зонд — CCG CCA ТТС AGA ATG САС АСА АТА TCG

1472-1498

wzx (0103)

САА GGT GAT ТАС GAA ААТ GCA TGT

4299-4323

И]

GAA AAA AGCACC ССС СТА СТТ АТ

99

4397-4375

AY532664

Зонд — AT AGC CTG TTG ТТТ ТАТ

4356-4373

18

ГОСТ ISO/TS 13136—2016

Приложение F

(обязательное)

Выделение чистых штаммов STEC

Данную методику используют для выделения чистых штаммов STEC из проб, положительно прореагировавших на ПЦР в режиме реального времени.

a)    В случае положительного результата о присутствии одного из генов, связанных с серогруппами рассматриваемых в рамках настоящего стандарта, проводится процедура обогащения, для облегчения выделения STEC (см. примечание 1).

b)    Обогащение проводится на ку/ътурвльных средах для обогащения SSE или на ТВХ или другой подходящей среде (см. примечание 2). Инкубируют в течение 18 ч до 24 ч при температуре (37 ± 1)*С.

c)    50 колоний Е. сов с характерной морфологией или с характерными признаками (см. примечание 5) снимают с питательного агара (NA) (см. примечание 3) и переносят в пробирки с водой (колонии могут быть объединены е воде 8 общей сложности по 10).

d)    Проводят детекцию на наличие sfx-кодирующих генов а изолированных колониях, перенесенных в воду (см. примечание 4).

e)    Если проба будет положительной, высевают клетки на питагвгъный агар для анализа отдельных колоний, чтобы выделить одну лоложигвгьную колонию.

f)    Идентифицируют колонии, как Е. сой. и подтверждают наличие еае-гена и принадлежность к серогруппе (например, с помощью ПЦР в режиме реального времени (см. приложении F. а также примечание 5).

д) Изопягы ДНК могут быть отправлены в референс-лаборагорию для дальнейшего подтверждения.

Примечание 1 — Обогащение конкретных серогрупп можно провести с помощью иммунологических систем, таких ках IMS или ее эквивалентов, при этом, как правило, следуют инструкциям производителя.

Примечание 2—Для подтверждения принадлежности проб к 0157 серогруппе применяют (19] или альтернативные методы, валидированые в соответствии с [18|. Принадлежность к сорбитол-ферментирующим Е. сой оерогрулпы 0157 определяют наличием теллурита, используя селективную среду СТ SMAC согласно (19]. Поэтому является целесообразным использование дублирующей чашхи Петри с SMAC без антибиотиков.

Для выделения STEC. принадлежащих к серогруппе 026. используют селективную плотную питательную среду (МакКонки). которая содержит рамнозу вместо лактозы (RMAC). Это очень эффективный способ выявления штаммов STEC оерогрулпы 026. которые не ферментируют рамнозу в отличив от других видов Е. со/г.

Примечание 3 — Существует несколько типов питательных сред на основе агара, либо в виде готовых к использованию чашек или для приготовления в лаборатории из сухих порошков. Каждый тип неселвкгианой питательной агаровой среды (например. TSA) подходит для целей выращивания колонии для дальнейшей дифференциации. Таюке можно использовать энгерогемолизичесхий агар. Это имеет преимущество, так как способность продуцировать энгврагемолвзин является общим признаком STEC патогенных для человека.

Примечание 4 — ПЦР в режиме реального времени, описанная в данном стандарте может быть использована для подтверждения наличия генов six и еае 8 геноме клеток выделенных штаммов. Стандартная ПЦР может быть использована в качестве альтернативы (см. приложение В).

Примечание 5 — Подтверждение принадлежности колоний к Е. сой можно провести при использовании любого коммерческого биохимического анализа, либо по способности клеток выделять индол. Дифференциация по серогруппам может быть проведена либо с помощью ПЦР. либо с помощью реакции агглютинации с испогъзо-ааниам коммерческой антисыворотки.

19

ГОСТ ISO/TS 13136—2016

Приложение ДА

(справочное)

Сведения о соответствии ссылочных международных стандартов межгосударственным стандартам

Таблица ДА.1

Обозначение ссылочного международною стандарта

Степень соотосте тема

Обозначение и наименование соответствующего межгосударственного стандарта

ISO 7218

ют

ГОСТ (SO 7218—2015 «Микробиология пищевых продуктов и кормов для животных. Общие требования и рекомендации по микробиологическим исследованиям»

ISO 20638

ISO 22174

«

*    Соответствующий межгосударственный стандарт отсутствует. До его принятия рекомендуется использовать перевод на русский язык данного международного стандарта. Официальный перевод данного международного стандарта находится в Федеральном информационном фонде стандартов.

Примечание — В настоящей таблице использовано следующее условное обозначение степени соответствия стандарта:

•    ЮТ — идентичный стандарт.

20

ГОСТ ISO/TS 13136—2016

Библиография

(1)    Scientific Opinion of the Panel on Biological Hazards (BIOHAZ) — Monitoring of verotoxigenic Escherichia coii (V TEC) and identification of human pathogenic V TEC types (Quest i on N о EFSA-Q-20 07-03 6) . Eur. Food Saf. Author. J. 2007. (579). pp. 1-61

(2)    Nielsen. E.M.. Andersen. M.T. Detection and characterization of verocytotoxin-produdng Escherichia coii by automated 5 nuclease PCR assay. J. Clin. Microbiol. 2003.41. pp. 2884-2893

(3)    Perelle. S.. Ditasser. F,. Grout. J.. Fach, P. Detection by 5' nuclease PCR of Shiga-toxin producing Escherichia coii 026. 055. 091. 0103. ОШ. 0113. 0145 and 0157:H7. associated with the world'smost frequent clinical cases. Mol. Cell Probes 2004. 18. pp. 185-192

(4)    Perelle. S.. Ddasser, F,. Grout. J.. Fach. P. Detection of Escherichia coii serogroup 0103 by realtime polymerase chain reaction. J. Appi. Microbiol. 2005. 98. pp. 1162-1168

(5)    Vimont. A.. Delignette-Muller. M.L.. Vemozy-Rozand. C. Supplementation of enrichment broths by novobiocin for detecting Shiga toxin-producing Escherichia coii from food: A controversial use. Lett. Appl. Microbiol. 2007. 44. pp. 326-331

(6)    Uemura. R.. Sueyosht. M.. Nagayoshi. M.. Nagatomo. H. Antimicrobial susceptibilities of Shiga toxinprodudng Escherichia coii isolates from pigs with edema disease in Japan. Microbiol. Immunol. 2003.47. pp. 57-61

(7)    Validation AFNOR des methodes alternatives d’analyse: Application a la nvcrobiologie alimentaire [AFNOR validation of alternative analytical methods: Application to food microbiology). Qutmper: Adria DeveloppemenL 56 p. Available {viewed 2012-10-17) at  GEN%2025- 06%2011 - 08%20(fr),pdf

(8)    KagKli. d.-m. Weber. LP. van den buIcKe. m.. Foiloni. s.. tozzoli. r.. morabito. s.. ermolli. m.gribaldo. I., van den eede. g. Application of the modular approach to an in-house validation study of real-time PCR methods for the detection and serogroup determination of verocytotoxigenic Escherichia coii. Appl. Environ. Microbiol. 2011. 77. pp. 6954—6963

(9)    EUROPEAN UNION REFERENCE LABORATORY VTEC. Proficiency tests and ring trials on detection and typing methods. Rome: Istituto Superiore di Sanita. Available (viewed 2012-10-17) at . php?id 147&lang2&bpo15

(10)    SambrooK. J.. Russel.. D.W. Molecular doning: A laboratory manual. 3rd edition. 3 vols. CokJ Spring Harbor. NY: Cold Spring Harbor Laboratory Press. 2001

(11)    Paton. A.W.. Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia ooli by using multiplex PCR assays for stx1, stx2. eaeA. enterohemorrhagic E. coii hfyA, r f b0111. and r №0157. J. Clin. Microbiol. 1998. 36. pp. 598-602

(12)    O'Brien. A. D.. NeWland, J.W.. Miller. S. F.. Holmes. R. K.. Smith. H.W.. Formal. S.B. Shiga-like toxinconverting phages from Escherichia coii strains that cause hemorrhagic colitis or infantile diarrhea. Science 1984.226. pp. 694-696

(13)    Pema. N.T.. PlunKett. ii. g.. burland. v.. mau, b.. glasner. J.d.. rose. d.J.. et al. Genome sequence of enterohaemor-rhagic Escherichia coii 0157:H7. Nature 2001. 409. pp. 529-533

(14)    HoorFar, J.. Malomy. B.. AbdulmaWJood. A.. CooK, N.. Wagner. M.. Fach, P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J. Clin. Microbiol. 2004. 42. pp. 1863-1868

(15)    Beutin. L.. Jahn, S.. Fach. P. Evaluation of the GeneDisc' real-time PCR system for detection of enterohaemorrhagic Escherichia coii (EHEC) 026. 0103. ОШ. 0145 and 0157 strains according to theirvirulence markers and their O- and H-antigen-associated genes. J. Appl. Microbiol. 2009.106. pp. 1122-32

(16)    ISO 7550    Лабораторная посуда — Одноразовые микролипегки

(17)    ISO 16140:2003 Микробиология пищевых продуктов и кормов для животных. Протокол валидации, альтернативные методы

(18)    ISO 16140-2 Микробиология пищевых продуктов и кормов для животных. Проверка Способ — Часть 2:

Протокол для проверки собственных методов против эталонного метода

(19)    ISO 166541' Микробиология пищевых продуктов и кормов для животных. Горизонтальный метод обна

ружения палочки Escherichia coii 0157

(20)    ISO/TS 19036:2006 Микробиология пищевых продуктов и кормов для животных. Руководящие принципы для оценки погрешности измерения для количественных определений

Ч Ввиду того, что на момент времени публикации ISO/TS 13136:2012 действовал только один ([19]). в котором приведен эталонный метод обнаружения серогруплы Е. Coii 0157 в пищевых продуктах, рассматриваемый метод был валидирован и сертифицирован только в рамках валидации NF (см. (7)) в отношении обнаружения STEC только серогруплы 0157.

В соответствии с данным исследованием часть метода, касающаяся серогруплы STEC 0157. была сертифицирована AFNOR как эквивалентная методу, приведенному в международном стандарте [17] (номер сертификата — GEN 25/04-11/08). Исчерпывающая информация по валидации приведена в [7].

21

ГОСТ ISO/TS 13136—2016

[21]    ISO 20637    Микробиология пищевых продуктов и кормов для животных. Полимеразная цепная реак

ция (ПЦР) для обнаружения пищевых патогенов — Требования к подготовке образцов для качественного обнаружения

[22]    Scheutz, F.. teel. I.d.. beutin. I.. Pierard. d.. buvens. g.. Kerch, h.. mellmann. a., caPrioli. a., tozzoli. r. morabito. s., strocKbtne. n.a., melton-celsa. a.r.. Sanchez, m.. Persson, s.. o'brien. a.d. A multi-center evaluation of a sequence-based protocol to subtype Shiga toxins and standardize Stx nomenclature. J. Clin. Microbiol. 2012 Jul 3

[23]    National center For emerging and zoonotic inFectious diseases, division oF Food borne. Waterborne, and environmental diseases. National Enteric Disease Sur veKlance: Shiga toxin-producing Escherichia coli (STEC) Annua! Summary. 2009. Bethesda. MD: CDC. 2012

[24]    EuroPean Food saFety authority and euroPean centre For disease Prevention and oontroi. The European Union Summary Report on Trends and Sources of Zoonoses. Zoonotic Agents and Food-bome Outbreaks in 2010. Eur. Food Saf. Author. J. 2012. 10. p. 2597

[25]    EuroPean Food saFety authority. Technical specifications for the monitoring and reporting of verotoxigenic Escherichia coli (VTEC) on animals and food (VTEC surveys on animals and food). Eur. Food Saf. Author. J. 2009. 7. p. 1366

[26]    Schmidt, h.. scheeF. J.. morabito. s., caPrioli. a.. Wieier. I.h.. Kerch, h. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl. Environ. Microbiol. 2000, 66. pp. 1205-8

[27]    Fricker. m.. messelhusser, u.. busch, u.. scherer, s.. ehlirtg-schulz. m. Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl. Environ. Microbiol. 2007. 73. pp. 1892-1898

22

ГОСТ ISO/TS 13136—2016

УДК 579.672:006.354    МКС 07.100.30    IDT

65.120

67.050

Ключевые слова: пищевая продукция, корма для животных, микробиология пищевой продукции и кормов для животных, полимеразная цепная реакция в режиме реального времени, определение патогенных микроорганизмов, горизонтальный метод определения Escherichia со//, Шига-токсин. STEC. серо-группы 0157, 0111. 026. 0103. 0145. амплификация

23

Сдано в набор 11.11.2016.

Редактор Л.Л. Штвндель Технический редактор В.Н. Прусакова Корректор М.В. Бучная Компьютерная верстка Е.Е. Кругова

Подписано в печать 09.12.2016. Формат 60 *64%. Гарнитура А риал.

Уел. печ. л. 3.26. Уч.-им. л. 2.9S. Тираж 31 эн Зах. 3113. Подготовлено «а основе эпмтрониой версии, предоставленной разработчиком стандарта

Издано и отпечатано во ФГУП «СТАНДАРТИНФОРМ». 12399S Москва. Гранатный пер.. 4.