База ГОСТовallgosts.ru » 65. СЕЛЬСКОЕ ХОЗЯЙСТВО » 65.120. Корма для животных

ГОСТ 34104-2017 Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени

Обозначение: ГОСТ 34104-2017
Наименование: Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени
Статус: Принят

Дата введения: 07/01/2018
Дата отмены: -
Заменен на: -
Код ОКС: 65.120
Скачать PDF: ГОСТ 34104-2017 Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.pdf
Скачать Word:ГОСТ 34104-2017 Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.doc


Текст ГОСТ 34104-2017 Корма и кормовые добавки. Метод идентификации генетически модифицированных линий сои, кукурузы и рапса c использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени



МЕЖГОСУДАРСТВЕННЫЙ СОВЕТ ПО СТАНДАРТИЗАЦИИ, МЕТРОЛОГИИ И СЕРТИФИКАЦИИ

(МГС)

INTERSTATE COUNCIL FOR STANDARDIZATION, METROLOGY AND CERTIFICATION

(ISC)

МЕЖГОСУДАРСТВЕННЫЙ

СТАНДАРТ

ГОСТ

34104—

2017

КОРМА И КОРМОВЫЕ ДОБАВКИ

Метод идентификации генетически модифицированных линий сои, кукурузы и рапса с использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени

Издание официальное

Москва

Стандартииформ

2017

ГОСТ 34104—2017

Предисловие

Цели, основные принципы и основной порядок проведения работ по межгосударственной стандартизации установлены в ГОСТ 1.0—2015 «Межгосударственная система стандартизации. Основные положения» и ГОСТ 1.2—2015 «Межгосударственная система стандартизации. Стандарты межгосударственные. правила и рекомендации по межгосударственной стандартизации. Правила разработки, принятия. обновления и отмены»

Сведения о стандарте

1    РАЗРАБОТАН Федеральным государственным бюджетным учреждением «Всероссийский государственный Центр качества и стандартизации лекарственных средств для животных и кормов» (ФГБУ «ВГНКИ»)

2    ВНЕСЕН Федеральным агентством по техническому регулированию и метрологии

3 ПРИНЯТ Межгосударственным советом по стандартизации, метрологии и сертификации (протокол от 1 июня 2017 г. N» 51)

За принятие проголосовали:

Краткое наименование страны по МК (ИСО 3166) 004-97

Код страны

по МК (ИСО 3166)004- 97

Сокращенное наименование национального ортана по стандартизации

Армения

AM

Минэкономики Республики Армения

Беларусь

BY

Госстандарт Республики Беларусь

Казахстан

KZ

Госстандарт Республики Казахстан

Киргизия

KG

Кыргыэстандарт

Россия

RU

Росстандарт

Таджикистан

TJ

Таджикстандарт

Узбекистан

UZ

Уастандарт

4 Приказом Федерального агентства по техническому регулированию и метрологии от 28 июня 2017 г. №593-стмежгосударственныйстандарт ГОСТ 34104—2017 введен в действие в качестве национального стандарта Российской Федерации с 1 июля 2018 г.

5 8ВЕДЕН ВПЕРВЫЕ

Информация об изменениях х настоящему стандарту публикуется е ежегодном информационном указателе «Национальные стандарты». а текст изменений и поправок — в ежемесячном информационном указателе «Национальные стандарты». В случае пересмотра (замены) или отмены настоящего стандарта соответствующее уведомление будет опубликовано в ежемесячном информационном указателе «Национальные стандарты». Соответствующая информация, уведомление и тексты размещаются также в информационной системе общего пользования — неофициальном сайте Федерального агентства по техническому регулированию и метрологии в сети Интернет ()

© Стандартинформ. 2017

В Российской Федерации настоящий стандарт не может быть полностью или частично воспроизведен. тиражирован и распространен в качестве официального издания без разрешения Федерального агентства по техническому регулированию и метрологии

ГОСТ 34104—2017

Содержание

1    Область применения...................................................1

2    Нормативные ссылки..................................................1

3    Термины и определения................................................2

4    Условия выполнения исследований и требования безопасности.......................2

5    Оборудование, материалы, реагенты........................................3

6    Сущность метода....................................................12

7    Отбор проб........................................................12

в Экстракция ДНК.....................................................12

9 Постановка ПЦР и проведение амплификации с гибридиэационмо*флуоресцвнтной детекцией

в режиме реального времени (Real Time PCR)..................................13

Приложение А (справочное) Требования к ПЦР-лаборатории.........................19

in

ГОСТ 34104—2017

МЕЖГОСУДАРСТВЕННЫЙ СТАНДАРТ

КОРМА И КОРМОВЫЕ ДОБАВКИ

Метод идентификации генетически модифицированных линий сои, кукурузы и рапса с использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального

времени

Feed end feed additives Method of Identification of genetically modified events of soybean, maize end rapeseed using

PCR with hybridization-fluorescence detection In real time

Дата введения — 2018—07—01

1    Область применения

Настоящийстандарт распространяется на корма: фуражное зерно, продукты его переработки; растительные корма: комбикорма для продуктивных и непродуктивных животных и сырье для их производства; кормовые добавки и устанавливает метод идентификации генно-модифицированной сои (далее — ГМ сои), генно-модифицированной кукурузы (далее — ГМ кукурузы) и генно-модифицированного рапса (далее — ГМ рапса) методом полимеразной цепной реакции (далее — ПЦР) с гибридизаци-онно-флуоресцентной детекцией в режиме реального времени (Real Time PCR).

2    Нормативные ссылки

8 настоящем стандарте использованы нормативные ссылки на следующие межгосударственные стандарты:

ГОСТ 12.0.004—2015 Система стандартов безопасности труда. Организация обучения безопасности труда. Общие положения

ГОСТ 12.1.004—91 Система стандартов безопасности труда. Пожарная безопасность. Общие требования

ГОСТ 12.1.005—68 Система стандартов безопасности труда. Общие санитарно-гигиенические требования к воздуху рабочей зоны

ГОСТ 12.1.007—76 Система стандартов безопасности труда, вредные вещества. Классификация и общие требования безопасности

ГОСТ 12.1.019—79 Система стандартов безопасности труда. Электробезопасность. Общие требования и номенклатура видов защиты*

ГОСТ 12.4.009—83 Система стандартов безопасности труда. Пожарная техника для защиты объектов. Основные виды, размещение и обслуживание

rOCTIS0 6497—2014 Корма. Отбор проб

ГОСТ ISO 7218—2015 Микробиология пищевых продуктов и кормов для животных. Общие требования и рекомендации по микробиологическим исследованиям

ГОСТ ИСО/МЭК17025—2009 Общие требования к компетентности испытательных и калибровочных лабораторий

ГОСТ 24760—81 Халаты медицинские женские. Технические условия

ГОСТ25194—82 Халаты медицинские мужские. Технические условия

ГОСТ 26678—85 Холодильники и морозильники бытовые электрические компрессионные параметрического ряда. Общие технические условия

ГОСТ 31719—2012 Продукты пищевые и корма. Экспресс-метод определения сырьевого состава (молекулярный)

' 8 Российской Федерации действует ГОСТ Р 12.1.019—2009.

Издание официальное

1

ГОСТ 34104—2017

Применение - При пользовании настоящим стандартом целесообразно проверить действие ссылочных стандартов в информационной системе общего пользования — на официальном сайте Федерального агентства ло техническому регулированию и метрологии в сети Интернет или по ежегодному информационному указателю «Национальные стандарты*, который опубликован по состоянию на 1 января текущего года, и по выпускам ежемесячного информационного указателя «Национальные стандарты* за текущий год. Если ссылочный стандарт заменен (изменен), то при пользовании настоящим стандартом следует руководствоваться заменяющим (измененным) стандартом. Если ссылочный стандарт отменен без замены, то положение, в котором дана ссылка на него, применяется в части, не затрагивающей ату ссылку.

3    Термины и определения

В настоящем стандарте применены следующие термины с соответствующими определениями:

3.1    амплификация: Процесс, многократно увеличивающий число копий фрагмента генома какого-либо организма.

3.2    генно-модифицированные (генно-инженерные, трансгенные) организмы: ГМО: Организм или несколько организмов, любое неклеточное, одноклеточное или многоклеточное образование, способные к воспроизводству или передаче наследственного генетического материала, отличные от природных организмов, полученные с применением методов генной инженерии и/или содержащие генно-инженерный материал, в том числе гены, их фрагменты или комбинации генов.

3.3    линия генно-модифицированного растения (генетически модифицированная линия. ГМ линия): Потомство от одного определенного генно-инжеиерно-модифицированногоорганиэма.

3.4    нуклеиновые кислоты. НК: Макромолекулы, являющиеся носителями генетической информации или выступающие в качестве посредника при синтезе полипептидной цели.

3.5    нуклеотидная последовательность: Порядок чередования нуклеотидных остатков в НК.

3.6    отрицательный контроль ПЦР: К-: Реакционная смесь для проведения ПЦР. заведомо не содержащая целевой нуклеиновый материал.

3.7    отрицательный контроль выделения (контроль чистоты выделения): К8: Контроль, прошедший все этапы выделения ДНК. но в отсутствие анализируемой пробы.

3.8    отрицательный контрольный образец: ОКО: Реакционная смесь, используемая вместо анализируемой пробы для контроля чистоты выделения ДНК.

3.9    полимеразная цепная реакция: ПЦР: Циклический ферментативный процесс, результатом которого является получение многочисленных копий определенного участка молекулы ДНК.

3.10    положительный контроль ПЦР: К+-: Реакционная смесь для проведения ПЦР, заведомо содержащая целевой нуклеиновый материал.

3.11    полимеразная цепная реакция в режиме реального времени: Полимеразная цепная реакция, проводимая по специальной технологии, которая позволяет регистрировать накопление ПЦР-продухтов в процессе амплификации.

3.12    ПЦР-продукт: ФрагменгДНК.амплифицироаанныйвПЦР.

3.13    праймер: Искусственно синтезируемая короткая последовательность нуклеотидов, комплементарная определенному участку целевой ДНК. используемая в полимеразной цепной реакции.

3.14    промотор: Последовательность нуклеотидов в молекуле ДНК. ответственная за начало транскрипции.

3.15    пороговый цикл Ct: Цикл амплификации, в котором кривая флуоресценции исследуемого образца пересекает линию порога (Threshold).

3.16    терминатор: Последовательность нуклеотидов в молекуле ДНК. ответственная за прекращение транскрипции.

3.17    целеваяДНК: ВыбраннаядляамплификациилоследоватепьностьДНК.

3.18    экстракция ДНК: Обработка анализируемой пробы, высвобождающая ДНК.

3.19    элюция: Извлечение вещества из твердого носителя вымыванием подходящим растворителем.

4    Условия выполнения исследований и требования безопасности

4.1    Условия выполнения исследований

4.1.1    Общие требования к помещениям — поГОСТ ISO 7218. ГОСТ ИСО/МЭК17025, ГОСТ 31719 (приложение А).

4.1.2    Требования кперсоналу — по ГОСТ ISO 7218 и ГОСТ ИСО/МЭК 17025.

2

ГОСТ 34104—2017

4.2 Требования безопасности

4.2.1    В лаборатории должно быть организовано обучение персонала безопасности труда в соот-ветствиисГОСТ 12.0.004.

4.2.2    При работе с химическими реактивами необходимо соблюдать общие требования бвзолас-кости обращения с вредными веществами, установленные ГОСТ 12.1.007.

4.2.3    Содержание вредных веществ в воздухе рабочей зоны не должно превышать норм, установленных ГОСТ 12.1.005.

4.2.4    При работе с электроустановками следует соблюдать требования электробезопасности, установленные в ГОСТ 12.1.019.

4.2.5    Помещение лаборатории должно соответствовать требованиям пожарной безопасности по ГОСТ 12.1.004. должно быть оснащено средствами пожаротушения по ГОСТ 12.4.009.

5 Оборудование, материалы, реагенты

5.1    Общие требования коборудоеанию — поИСО/МЭК 17025.

5.2    При проведении испытаний применяют оборудование и материалы по ГОСТ 31719. с дополнением:

•    бокс ламинарный, класс биологической безопасности НтипА2:

•    термостат, обеспечивающий температуру нагрева до 100 "С;

•    отсасыватвль вакуумный медицинский с колбой-ловушкой для удаления надосадочной жидкости;

•    центрифуга для микропробирок вместимостью 1.5 см3, со скоростью вращения не менее 12000 об/мин:

•    миницентрифуги-встряхиватели с роторами для микропробирок вместимостью 0.2:0.6 и 1.5 см3, со скоростью вращения не менее 2400 об/мин:

•    микропробирки одноразовые полипропиленовые завинчивающиеся или плотно закрывающиеся вместимостью 1.5 см3:

•    микропробирки одноразовые полипропиленовые вместимостью 0.2 см3:

•    одноразовые наконечники для дозаторов переменного объема с аэрозольным барьером объемом 10 мм3,100 мм3.200 мм3.1000 мм3:

•    ПЦР-бокс:

•    прибор для проведения полимеразной цепной реакции в режиме реального времени*:

•    халаты медицинские по ГОСТ 24760 и ГОСТ 25194;

•    холодильник бытовой электрический по ГОСТ 26676. обеспечивающий поддержание температуры от 2 °С до 8 *С. с морозильной камерой, обеспечивающей поддержание температуры не выше минус 16 °С.

Допускается использование другого оборудования, материаловстехническими характеристиками не ниже указанных.

Допускается использование роботизированных станций для пробоподготовки. выделения дезоксирибонуклеиновой кислоты (ДНК) и раскапывания готовой многокомпонентной смеси для ПЦР.

5.3    При проведении испытаний применяют реагенты для экстракции ДНК. реагенты, праймеры и зонды для проведения ПЦР и амплификации. Для экстракции ДНК допускается использовать готовые наборы**.

5.3.1 Реагенты:

а) набор реагентов для экстракции ДНК. включающий:

1)    буфер для лизирующего реагента, содержащий хаотролкый агент гуанидин хлорид:

2)    лизирующий реагент, содержащий протеиназу К:

3)    раствор для отмывки Ns 1 для очистки от клеточных белков, содержащий хаотропный агент гуанидин тиоцианат:

* Прибор для проведения ПЦР «Rotor-Gene» 2000/3000/6000 («Corbett Research». Австралия). «Rotor Gene О* («Qlagen», Германия). Денная информация является рекомендуемой и лриведенв для удобства пользователей настоящего стандарте.

” Примером могут служить наборы «ДНК-СОРБ-С» (ФГБУН ЦНИИ Эпидемиологии Роспотребнадзора, форма 1 ret К 1-6-50/ver, 05/06/16). «Сорб-ГМО-А» и «Сорб-ГМО-Б* (ЗАО «Синтол». каталожный номер GM-S03). Данная информация является рекомендуемой и приведена для удобстве пользователей нестоящего стандарта.

3

ГОСТ 34104—2017

4)    раствор для отмывки № 2 для очистки от солей, содержащий водный раствор изопропилового спирта;

5)    сорбент (25%-ная вэвесьчастиц силикагеля Si02 размером от 20 до 50 мкм в растворе Трис-НО молярной концентрации 5 ммоль/дм3);

6)    буфер для элюции ДНК (ТЕ-буфер) — Трис-HCI молярной концентрации 10 ммоль/дм3; натриевая соль этилендиаминтетрауксусной кислоты молярной концентрации 1 ммоль/дм3;

б)    вода деионизированная, класса чистоты I. свободная от рибонуклеаз. дезоксирибонуклеаз, неорганических и органических примесей с удельным сопротивлением не менее 18 Мом • см;

в)    ПЦР-6уферсМдС12;

г)    смесь олигонуклеотидов (праймеры) по 5.3.2 или 5.3.3;

д)    смесь олигонуклеотидов (зонды, меченные флуоресцентными красителями FAM и R6G) по

5.3.2 или 5.3.3;

е)    раствор деэоксинуклеозидтрифосфатое (дНТФ). содержащий натриевые соли дНТФ со степенью очистки более 98 % и концентрацией каждой 2 моль/дм3:

ж)    термостабильная Taq-полимераза;

и) сертифицированные стандартные образцы ГМ линий сои. ГМ линий кукурузы или ГМ линий ралса*.

Допускается использование других реагентов с техническими характеристиками не хуже указанных.

5.3.2    Для выявления фрагментов видослецифичной ДНК растений допускается использование наборов реагентов (готовых тест-систем), содержащих праймеры, специфичные к ДНК определенного вида растений.

5.3.3    Допускается использование синтезированных олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои. кукурузы и рапса. Список последовательностей всех используемых олигонуклеотидов приведен в таблицах 1—3. где указаны последовательности:

1)    для прямых и обратных праймеров и зондов**, специфичных конкретной ГМ линии;

2)    прямых и обратных праймеров и зондов, специфичных фрагменту генома растения (ген лектина для сои. ген зеина для кукурузы, ген круцифврина А для рапса).

Табл ицв 1 — Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои

Линия ГМ сои

Последовательность

Наименование

S'-З' последовательность

40-3-2

Целевая

40-3-2F

GCCATGTTGTTAATTTGTGCCAT

40-3-2R

GAAGTTCATTTCATTTGGAGAGGAC

40-3-2Р

FAM-CTTGAAAGATCTGCTAGAGTCAGCTTGTCAGC

G-BHQ1

Растительная

L6C40-3-2F

TCCACCCCCATCCACATTT

L6C40-3-2R

ggcatagaaggtgaagttgaagga

LBC40-3-2P

R6G-AACCGGTAGCGTTGCCAGCTTCG-8H01

A5S47-127

Целевая

A5647F

gctatttggtggcatttttcca

A5547R

CACTGCGGCCAACTTACTTCT

А5547Р

FAM-CCGCAATGTCATACCGTCATCGTTGT-8H01

Растительная

LBCAS647F

CTTTCTCGCACCAATTGACA

LecA5647R

tcaaactcaacagcgacgac

LecA5547P

R6G-CCACAAACACATGCAGGTTATCTTGG-flHQl

* Сертифицированные стандартные образцы производства jrmm. Бельгия: AOCS. США (материалы, состоящие из высушенной гомогенизированной муки соевых бобов, ралса или кукурузы, включающих смеси ГМ и не ГМ растений соответствующих видов, содержащие от 0.1 % до 100 % генетически модифицированных материалов). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.

Маркировки а наименовании: «Р» — прямой праймер. *R* — обратный праймер. «Р» — зонд.

ГОСТ 34104—2017

Продолжение таблицы 1

Линия ГМ сои

Последовательность

Наиыеиование

S‘>3‘ последовательности

А2704-12

Целевая

A2704F

GCAAAAAAGCGGTTAGCTCCT

A2704R

ATTCAGGCTGCGCAACTGTT

А2704Р

FAM-CGGTCCTCCGATCGCCCTTCC-BHQ1

Растительная

L6CA2704F

CACCTTTCTCGCACCAATTGACA

LecA2704R

TCAAACTCAACAGCGACGAC

L6CA2704P

R6G-CCACAAACACATGCAGGTTATCTTGG-BHQ1

MON89788

Целевая

MON89788F

TCCCGCTCTAGCGCTTCAAT

MON89768R

TCCCGCTCTAGCGCTTCAA

MON89788P

FAM-CTGAAGGCGGGAAACGACAATCTG-8HQ1

Растительная

LecMON89788F

CCAGCTTCGCCGCTTCCTTC

LecMON89788R

GAAGGCAAGCCCATCTGCAAGCC

LecMON89788P

ReG-CTTCACCTTCTATGCCCCTGACAC-BHOl

MON87701

Целевая

MON87701F

TGGTGATATGAAGATACATGCTTAGCAT

MON87701R

CGTTTCCCGCCTTCAGTTTAAA

MON87701P

FAM-TCAGTGTTTGACACACACACTAAGCGTGCC-B

HOI

Растительная

L6C87701F

CCAGCTTCGCCGCTTCCTTC

Lec87701R

GAAGGCAAGCCCATCTGCAAGCC

L6C87701P

R6G-CTTCACCTTCTATGCCCCTGACAC-BH01

BPS-

CV127-9

Целевая

BPSF

AACAGAAGTTTCCGTTGAGCTTTAAGAC

BPSR

CATTCGTAGCTCGGATCGTGTAC

BPSP

FAM-TTTGGGGAAGCTGTCCCATGCCC-BHQ1

Растительная

LecBPSF

CCAGCTTCGCCGCTTCCTTC

LecBPSR

GAAGGCAAGCCCATCTGCAAGCC

LecBPSP

R6G-CTTCACCTTCTATGCCCCTGACAC-BH01

SYHTOH2

Целевая

SyhF

G G GAAT TG G GTACCATGCC

SyhR

TGTGTGCCATTGGTTTAGGGT

SyhP

FAM-CCAGCATGGCCGTATCCGCAA-BHQ1

Растительная

LecSyhF

CCAGCTTCGCCGCTTCCTTC

LecSyttR

GAAGGCAAGCCCATCTGCAAGCC

LecSyhP

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

FG72

Целевая

FG72F

AGATTTGATCGGGCTGCAGG

FG72R

GCACGTATTGATGACCGCATTA

FG72P

FAM- AATGTGGTTCATCCGTCTTTTTTG-BHQ1

Растительная

LecFG72F

CTTTCTCGCACCAATTGACA

LecFG72R

TCAAACTCAACAGCGACGAC

LecFG72P

R8G-CCACAAACACATGCAGGTTATCTTGG-BH01

DP-308423

Целевая

305423F

CGTGTTCTCTTTTTGGCTAGC

305423R

GTGACCAATGAATACATAACACAAACTA

305423P

FAM-TGACACAAATGATTTTCATACAAAAGTCGAGA-

8H01

5

ГОСТ 34104—2017

Продолжение таблицы 1

Линия ГМ сои

Последовательность

Наименование

5'-3' последовательность

DP-305423

Растительная

Lec305423F

CCAGCTTCGCCGCTTCCTTC

Lec305423R

GAAGGCAAGCCCATCTGCAAGCC

L6C305423P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

DP-356043

Целевая

356043F

GTCGAATAGGCTAG6TTTACGAAAAA

356043R

TTTGATATTCTTGGAGTAGACGAGAGTGT

35604ЭР

FAM-CTCTAGAGATCCGTCAACATGGTGGAGCAC-BH

Q1

Растительная

lec356043F

CCAGCTTCGCCGCTTCCTTC

Lec356043R

GAAGGCAAGCCCATCTGCAAGCC

L6C3S6043P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87705

Целевая

Mon87705F

TTCCCGGACATGAAGCCATTTAC

Mon87705R

ACAACGGTGCCTTGGCCCAAAG

МОП87705Р

fam-aagagactcagggtgttgttatcactgcgg-bh

G1

Растительная

LecMon87705F

CCAGCTTCGCCGCTTCCTTC

LecMon8770SR

GAAGGCAAGCCCATCTGCAAGCC

LecMon8770SP

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87708

Целевая

Mon87708F

TCATACTCATTGCTGATCCATGTAG

Mon67708R

AGAACAAATTAACGAAAAGACAGAACG

МОП87708Р

FAM-TCCCGGACTTTAGCTCAAAATGCATGTA-BHOl

Растительная

LecMon87708F

CCAGCTTCGCCGCTTCCTTC

LecMofl87708R

GAAGGCAAGCCCATCTGCAAGCC

LecMon87708P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

MON87769

Целевая

Mon87769F

CATACTCATTGCTGATCCATGTAGATT

Mon87769R

GCAAGTTGCTCGTGAAGTTTTG

МОЛ87769Р

FAM-CCCGGACATGAAGCCATTTACAATTGAC-BHQ1

Растительная

LecMon87769F

CCAGCTTCGCCGCTTCCTTC

LecMon87769R

GAAGGCAAGCCCATCTGCAAGCC

LecMon87769P

R6G-CTTCACCTTCTATGCCCCTGACAC-BHQ1

DAS-44406

Целевая

DAS-44406F

TTA TTG TTC TTG TTG TTT CCT CTT TAG G

OAS-44406R

CCT CAA TTG CGA GCT TTC TAA TTT

OAS-44406P

FAM- ATT CGG ACC TCC ATG ATG ACC TTA CCG TT -BH01

Растительная

LecDAS-44406F

CCA GCT TCG CCG CTT CCT TC

LecDAS-44406R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS-44406P

FAM- CTT CAC CTT СТА TGC CCC TGA CAC- BHQ1

OAS-81419

Целевая

DAS 81419F

TCT AGC СТА TAT TTA GCA CTT GAT ATT CAT

OAS 81419R

GCT TCA AGA TCC CAA CTT GCG

OAS81419P

FAM-ATC AAC AGG CAC CGA TGC GCA CCG- BHQ1

6

ГОСТ 34104—2017

Окончание таблицы 1

Линия ГМ сои

Последовательность

Наименование

S’-3' последовательность

DAS-81419

Растительная

Lee DAS81419F

CCA GCT TCG CCG CTT CCT TC

LecDAS 81419R

GAA GGC AAG CCC АТС TGC AAG CC

LecOAS 81419Р

FAM-CTT CAC CTT СТА TGC CCC TGA CAC- 8HQ1

OAS-68416

Целевая

OAS 68416F

GTA CAT TAA AAA CGT CCG CAA TGT GT

OAS 66416R

GTT TAA GAA TTA GTT CTT АСА GTT TAT TGT TAG

DAS 68416P

FAM-TTA AGT TGTCTA AGC GTC AAT A-MGBNFO

Растительная

Lee DAS 66416F

CCA GCT TCG CCG CTT CCT TC

LecDAS 68416R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS 66416P

FAM-CTT CAC CTT СТА TGC CCC TGA CAC- 8H01

Та6лица2— Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий кукурузы

Линия ГМ кукурузы

Посп ед ом теп ь• кость

Наименование

S'-3' последовательность

GA21

Целевая

GA21 F

CTT АТС GTT ATG СТА T7T GCA ACT TTA GA

GA21 R

TGG CTC GCG АТС CTC CT

GA21 Р

FAM- CAT АТА СТА ACT CAT АТС TCT TTC ТСА АСА GCAGGTGGGT-BH01

Растительная

Adh GA21 F

CCA GCC TCA TGG CCA AAG

Adh GA21 R

CCT TCT TGG CGG CTT АТС TG

Adh GA21 P

R6G- CTT AGG GGC AGA CTC CCG TGT ТСС CT • 8HQ1

MON810

Целевая

МОП810F

TCG AAG GAC GAA GGA CTC TAA CGT

Мол810 R

GCC ACC TTC CTT TTC CAC TAT CTT

Mor.810 P

FAM- AAC АТС CTT TGC CAT TGC CCA GC -BH01

Растительная

Hmg Mon810 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Моп810 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg Моп810 P

R6G- CAA ТСС АСА CAA ACG CAC GCG ТА -BHOI

MON89034

Целевая

МОЛ89034 F

TTC ТСС ATA TTG ACC АТС АТА CTC ATT

МОЛ89034 R

CGG TAT СТА TAA TAC CGT GGT TTT TAA A

МОЛ89034 P

FAM-ATCCCCGGAAATTATGTT-MGBNFQ

Растительная

Hmg Mon89034 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon89034 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg Mon89034 P

R6G- CAA ТСС АСА CAA ACG CAC GCG ТА -BHOI

NK603

Целевая

NK603F

ATG AAT GAC CTC GAG TAA GCT TGT TAA

NK603 R

AAG AGA TAA CAG GAT CCA CTC AAA CAC T

NK603P

FAM- TGG TAC CAC GCG АСА CAC TTC CAC TC -BHQ1

Растительная

Agh NK603 F

CCA GCC TCA TGG CCA AAG

Agh NK603 R

CCT TCT TGG CGG CTT АТС TG

Agh NK603 P

R6G- CTT AGG GGC AGA CTC CCG TGT TCC CT -8H01

7

ГОСТ 34104—2017

Продолжение таблицы 2

Линия ГМ кукурузы

Последователь* и ость

Наименование

5'-Э‘ последовательность

ВИ1

Целевая

ВШ F

GCG GAA CCC СТА TTT GTT ТА

В111 R

ТСС AAG AAT CCC TCC ATG AG

ВШ Р

FAM- AAA TAC ATT CAA ATA TGT АТС CGC TCA -BHQ1

Растительная

Adh Bt11 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh BI11 R

CCA CTC CGA GAC CCT CAG TC

Adh Btl 1 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -8HQ1

Т25

Целевая

T25F

АСА AGC GTG TCG TGC TCC AC

T25R

GAC ATG ATA CTC CTT CCA CCG

T25P

FAM- TCA TTG AGT CGT TCC GCC ATT GTC G -8H01

Растительная

Adh T2S F

CGT CGT TTC CCA TCT CTT CCT CCT

Adh T25 R

CCA CTC CGA GAC CCT CAG TC

Adh T25 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -8H01

MIR604

Целевая

MIR604 F

GCG CAC GCA ATT CAA CAG

MIR604 R

GGT CAT AAC GTG ACT CCC TTA ATT CT

MIR604 P

FAM- AGGCGGGAAACGACAATCTGATCATG-BH01

Растительная

Adh MIR604 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR604 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR604 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -8HQ1

MON 88017

Целевая

MON 88017 F

GAG CAG GAC CTG CAG AAG CT

MON 88017 R

TCC GGA GTT GAC CAT CCA

MON 88017 P

FAM- TCC CGC CTT CAG TTT AAA CAG AGT CGG GT -8H01

Растительная

Hmg MON 88017 F

TTG GAC TAG AAA TCT CGT GCT GA

HmgMON 88017 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg MON 88017 P

R6G- CAA TCC АСА CAA ACG CAC GCG ТА -8H01

3272

Целевая

3272 F

TCA TCA GAC CAG ATT CTC TTT TAT GG

3272 R

CGT TTC CCG CCT TCA GTT ТА

3272 P

FAM- ACT GCT GAC GCG GCC AAA CAC TG -BHQ1

Растительная

Adh 3272 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh 3272 R

CCA CTC CGA GAC CCT CAG TC

Adh 3272 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -8H01

MIR162

Целевая

MIR162F

GCG CGG TGT CAT СТА TGT TAC TAG

MIR162R

TGC CTT АТС TGT TGC CTT CAG A

MIR162P

FAM- TCT AGA CAA TTC AGT АСА TTA AAA ACG TCC GCCA-8H01

Растительная

Adh MIR162 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR162 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR162 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -8HQ1

8

ГОСТ 34104—2017

Продолжение теблицы 2

Линия ГМ кукурузы

Последомтель-

кость

Наименование

5'-3' последовательность

5307

Целевая

5307 F

CAT GGC CGT АТС CGC AAT GTG

5307 R

TGC ACC CTT TGC CAG TOG

5307 Р

FAM-ACC АСА АТА TAC CCT CTT CCC TGG GCC AG-BHOl

Растительная

Adh 5307 F

CGT СОТ TTC CCA TCT CTT CCT CC

Adh 5307 R

CCA CTC CGA GAC CCT CAG TC

Adn 5307 P

R6G -AAT CAG GGC TCA TTT TCT CGC ТСС TCA-BH01

ВМ 76

Целевая

Bt176 F

GGC CGT GAA CGA GCT GTT

BI176R

GGG AAG AAG CCT АСА TGT TTT СТА A

Bt176 P

FAM-AGC AAC CAG АТС GGC CGA CAC C-BHQ1

Растительная

Adh Bt176 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh Bt176 R

CCA CTC CGA GAC CCT CAG TC

Adh Bt176 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MON 98140

Целевая

MON 98140 F

GTG TGT ATG TCT CTT TGC TTG GTC TT

MON 96140 R

GAT TGT CGT TTC CCG CCT TC

MON 98140 P

FAM-CTC TAT CGA TCC CCC TCT TTG ATA GTT TAA ACT-8H01

Растительная

Hmg 98140 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 98140 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg 98140 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

MON87460

Целевая

МОП87460 F

CAC GTT GAA GGA AAA TGG ATT G

МОП87460 R

TCG CGA TCC TCC TCA AAG AC

МОП87460 P

FAM-AGG GAG TAT GTA GAT AAA TTT TCA AAG CGT TAG ACGGC-BHQ1

Растительная

Hmg МОЛ87460 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon87460 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg Моп87460 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

MON663

Целевая

Мол863 F

GTA GGA TCG GAA AGC TTG GTA C

Mor.863 R

TGT TAC GGC СТА AAT GCT GAA CT

МолббЗ P

FAM-TGA АСА CCC АТС CGA АСА AGT AGG GTC A-BHQ1

Растительная

Adh МОЛ86Э F

CCA GCC TCA TGG CCA AAG

Adh МОЛ883 R

CCT TCT TGG CGG CTT АТС TG

Adh Mon863 P

R6G-CTT AGG GGC AGA CTC CCG TGT TCC CT-BHQ1

ТС1507

Целевая

TCI 507F

TAG TCT TCG GCC AGA ATG G

TC1S07R

CTT TGC CAA GAT CAA GCG

TCI 507P

FAM-TAA CTC AAG GCC CTC ACT CCG-BHQ1

Растительная

Hmg TC1507F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg TC1507R

GCT АСА TAG GGA GCC TTG TCC T

Hmg TCI507 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

9

ГОСТ 34104—2017

Окончание таблицы 2

Линия ГМ кукурузы

Последователь*

иость

Наименование

5'-Э‘ последовательность

59122

Целевая

59122F

GGGATAAGCAAGTAAAAGCGCTC

59122R

CCTTAATTCTCCGCTCATGATCAG

59122Р

FAM-TTTAAACTGAAGGCGGGAAACGACAA-8HG1

Растительная

Hmg 59122 F

GCT АСА TAG GGA GCC TTG ТСС T

Hmg 59122 R

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 59122 P

R6G-CAA ТСС АСА CAA ACG CAC GCG TA-8HQ1

LY038

Целевая

LY038F

TGG GTT CA6 TCT GCG AAT OTT

LY038R

AGG AAT TCG АТА TCA AGC TTA TCG A

LY038P

FAM-CGA GCG GAG TTT ATG GGT CGA CGG-8H01

Растительная

Hmg LY038 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg LY038 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg LY038 P

R8G-CAA ТСС АСА CAA ACG CAC GCG TA-BHOl

О AS-40278-9

Целевая

DAS40278 F

CAC GAA CCA TTG ACT TAC AAT C

DAS40278 R

TGG TTC ATT GTA TTC TGG CTT TG

OAS40278 P

FAM-CGT AGC TAA CCT TCA TTG TAT TCC G-8HQ1

Растительная

Hmg 40278 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 40278 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg 40278 P

R6G-CAA ТСС АСА CAA ACG CAC GCG TA-8HQ1

Таблица 3—Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий репса

Линия ГМ рапса

Последователь*

иость

Наименование

5 -Э' последоаательносгь

GT73

Целевая

RT73-F

CCATATTGACCATCATACTCATTGCT

RF3-R

GCTTATACGAAGGCAAGAAAAGGA

RT73-Z

FAM-TTCCCGGACATGAAGATCATCCTCCTT-BHQ1

GT73

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

CCGTCGTTGTAGAACCATTGG

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

MON68302

Целевая

MON88302-F

TCCTTGAACCTTATTTTATAGTGCACA

MON88302-R

TCAGATTGTCGTTTCCCGCCTTCA

MON88302-Z

FAM-TAGTCATCATGTTGTACCACTTCAAACACT-8HQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

CCGTCGTTGTAGAACCATTGG

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

MS1

Целевая

Mel-F

ACGCTGCGGACATCTACATT

MS1-R

CTAGATCGGAAGCTGAAGATGG

MS1-Z

FAM-CTCATTGCTGATCCACCTAGCCGACTT-SHOI

10

ГОСТ 34104—2017

Окончание таблицы 3

Линия ГМ репса

Последе еатель* пост*

Наименомние

5'-3' последом гельмость

MS1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-8HG1

MS8

Целевая

MS8-F

GTTAGAAAAAGTAAACAATTAATATAGCCGG

MS8-R

GGAGGGTGTTTTTGGTTATC

MS6-Z

FAM-AATATAATCGACGGATCCCCGGGAATTC-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-8H01

Т45

Целевая

T45-F

CAATGGACACATGAATTATGC

T45-R

GACTCTGTATGAACTGTTCGC

T45-Z

FAM-TAGAGGACCTAACAGAACTCGCCGT-8HQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Repe-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-8HQ1

RF1

Целевая

RF1-F

CTAAGGGAGGTCAAGATGTAGC

RF1-R

CGGGCC T A ACT T T TGGTGTG

RF1-Z

FAM-CTCATCATCCTCACCCAGTCAGCATCA-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-eruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-8HG1

RF2

Целевая

RF2-F

GGGTGAGACAATATATCGACG

RF2-R

GGGCATCGCACCGGTGAG

RF2-Z

FAM-CACCGGCCAAATTCGCTCTTAGCCGT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1

RF3

Целевая

RF3-F

CATAAAGGAAGATGGAGACTTGAG

RF3-R

AGCATTTAGCATGTACCATCAGACA

RF3-Z

FAM-CGCACGCTTATCGACCATAAGCCCA-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Repe-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGGTGCA-8HQ1

Тора»

19/2

Целевая

TOPAS19/2-F

GTTGCGGTTCTGTCAGTTCC

TOPAS19/2-R

CGACCGGCGCTGATATATGA

TOPAS19/2-Z

FAM-TCCCGCGTCATCGGCGG-BHOl

Растительная

Rape-cruA-F

GGCCAGGGTTTCCGTGAT

Rape-cruA-R

TCAGATTGTCGTTTCCCGCCTTCA

Rape-cruA-Z

R6G-AGTCCTTATGTGCTCCACTTTCTGG TGCA-8HQ1

11

ГОСТ 34104—2017

6    Сущность метода

6.1    Сущность метода идентификации ГМ пиний сои. кукурузы и рапса методом ПЦР с гибридиза-ционно-флуоресцектной детекцией в режиме реального времени (Real Time PCR) заключается в проведении двух независимых ПЦР в одной пробирке с использованием специфичных праймеров и зондов, меченныхфлуоресцентными красителями, с целью выявления участка видослвцифичной ДНК растений (сои. кукурузы или рапса) и части генно-инженерной конструкции, специфичной для генома тестируемой генетически модифицированной линии.

6.2    Метод состоит из следующих этапов:

-    экстракция и очистка ДНК: на данном этапе осуществляется лизис клеток с последующей очисткой ДНК от балластных веществ (белков, полисахаридов и других соединений);

-    ПЦР с использованием специфических праймеров и зондов, меченных флуоресцентным красителем. На данном этапе осуществляется накопление копий целевого участка ДНК и детекция ПЦР-лро-дуктое в режиме «реального времени»;

• анализ и интерпретация результатов происходит на основании наличия (или отсутствия) пересечения кривой флюоресценции с установленной на соответствующем уровне пороговой линией на графике зависимости интенсивности флюоресценции от количества циклов, что соответствует значениям порогового цикла Ct.

7    Отбор проб

Общие правила отбора проб для испытаний должны соблюдаться в соответствии с требованиями ГОСТ ISO 6497.

8    Экстракция ДНК

8.1 Экстракцию ДНК из анализируемой пробы осуществляют с использованием набора реагентов для экстракции ДНКсорбционным методом по 5.3 или иным методом, позволяющим получить достаточный объем ДНК для последующих исследований. Объем ДНК. необходимый для проведения исследований. вычисляют по формулам:

V„*10 N.    (1)

где V" — объем ДНК. необходимый для проведения идентификации линий:

N — количество идентифицируемых линий;

УВ8И0 2W.    (2)

где V4 — объем ДНК. необходимый для проведения количественного анализа.

8.2    Буфер для лизирующего реагента и раствор для отмывки № 1 (если они хранились при температуре от 2 ®С до 8*0) прогревают на поверхности твердотельного термостата при температуре от 60 вС до 64 *С до полного растворения кристаллов.

8.3    Отбирают необходимое количество одноразовых пробирокобъемом 1.5 см3 (включая отрицательный контроль выделения). В пробирки вносят анализируемые пробы. В пробирку отрицательного контроля выделения ДНК вносят 100 мм3 ОКО.

8.4    Отдельными наконечниками с аэрозольным барьером вносят в каждую пробирку по 400 ммбуфера для лизирующего реагента и по 17 мм3 лизирующего реагента. Тщательно перемешивают содержимое пробирок на встряхиеателе в течение 10 с.

8.5    Пробирки инкубируют в термостате при температуре 64 вС в течение 1 ч. периодически встряхивая на встряхиеателе (пять раз через каждые 10—12 мин).

8.6    Нерастворенные частицы анализируемой пробы осаждают центрифугированием при 12—14 тыс. об/мин в течение 5 мин.

8.7    Надосадочную жидкость в объеме 200—350 мм3 очень аккуратно (так, чтобы не лопали взвешенные частицы и капли жира) отбирают отдельными наконечниками с аэрозольными барьерами и переносят в новые пробирки.

8.8    Пробирки с надосадочной жидкостью прогревают в течение 5 мин в термостате при температуре 64 ®С, перемешивают содержимое пробирок и центрифугируют в течение 5 с при 5 тыс. об/мин для сброса капель с крышки пробирки.

12

ГОСТ 34104-2017

8.9    В каждую пробирку отдельным наконечником добавляют по 25 мм3 сорбента, предварительно помещенного во встряхиватель для получения однородной суспензии. Содержимое пробирок перемешивают на встряхивателе и инкубируют при комнатной температуре в течение 10—15 мин. перемешивая через каждые 2 мин. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Над осад очную жидкость удаляют, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.10    8 пробирки добавляютпо 300 мм3 раствора для отмывки Nel. Перемешивают на встряхивателе до полного ресуспендирования сорбента. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Удаляют кадосадочную жидкость, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.11    Процедуру отмывки повторяют дважды, используя по 500 мм3 раствора для отмывки Nff 2. и центрифугируют в течение 30 с при 7 тыс. об/мин. удаляют надосадочную жидкость полностью.

8.12    Пробирки сотмытым сорбентом помещают в термостат при температуре 64 *С на 10 мин для подсушивания сорбента. При этом крышки пробирок должны быть открыты.

8.13    8 пробирки добавляют по50 мм3 буфера дляэлюции ДНК ипервмешивают на встряхивателе. Помещают в термостат при температуре 64 ®С на 5 мин и периодически (один раз в минуту) встряхивают на встряхивателе. Пробирки центрифугируют при 12 тыс. об/мин в течение 1 мин.

8.14    Надосадочная жидкость содержит очищенную ДНК. которую затем используют для постановки ПЦР и проведения амплификации. Очищенную ДНК можно хранить в течение одной недели при температуре от2*Сдо8*Сив течение года при температуре не выше минус 16 *С. Для этого рекомендуется перенести надосадочную жидкость в чистую микролробирку.

9 Постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR)

9.1    Приготовление реакционной ПЦР-смеси

Для приготовления реакционной ПЦР-смеси для определения генетически модифицированной линии сои, кукурузы или рапса берут 1 мм3 деионизированной воды, по 1 мм3 каждого соответствующего праймерас маркировкой «F» по 5.3.2 концентрацией 5 • 10'в моль/дм3. по 1 мм3 каждого праймерас маркировкой «R» по 5.3.2 концентрацией 5 10 6 моль/дм3. по 1 мм3 каждого зонда с маркировкой «Р» по

5.3.2 концентрацией 3 10~б моль/дм3, 3 мм3 раствора дНТФ и смешивают в пробирке вместимостью 1.5 см3. Срок хранения готовой ПЦР-смеси при температуре не выше минус 18 *С — не более 12 мес.

9.2    Постановка ПЦР

9.2.1    ДНК. экстрагированную из анализируемой пробы (включая стандартные образцы), испытывают не менее чем в двух повторностях.

9.2.2    Для проведения ПЦР в одной пробирке смешивают 10 мм3 ПЦР-смеси по 9.1, к которой добавляют 5 мм3 ПЦР-буфера и 0.5 мм3 термостабильной Taq полимеразы. Смесь перемешивают на встряхивателе. осаждая кратковременным центрифугированием.

9.2.3    Вносят по 15 мм3 смеси, полученной по 9.2.2. в микропробирку вместимостью 0.2 см3, затем, используя наконечнике аэрозольным барьером, добавляютв нее 10 мм3 ДНК. полученной из анализируемой пробы (ДНК-проба) в соответствии с разделом 8. Общий объем реакционной смеси — 25 мм3.

Примечание — Необходимо избегать попадания сорбента в реакционную смесь.

9.3    Контрольные реакции амплификации:

•    отрицательный контроль ПЦР (К-) — вместо ДНК-лробы в микропробирку с 15 мм3 смеси по 9.2.2 вносят 10 мм3 ТЕ-буфера:

•    положительный контроль ПЦР (К+) — вместо ДНК-пробы емикропробирку с 15 мм3 смеси ло9.2.2 вносят 10 мм3 1 %-ного стандартного образца состава ГМ сои. ГМ кукурузы или ГМ рапса.

9.4    Проведение амплификации и детекции флуоресцентного сигнала

Программируют прибор для проведения полимеразной цепной реакции в режиме реального времени в соответствии с инструкцией по эксплуатации.

Программы амплификации для идентификации линий ГМ сои. кукурузы и рапса различаются для разных ГМ линий и приведены в таблицах 4—11.

Программа амплификации для идентификации ГМ сои линий 40-3-2. А5547-127. А2704-12 приведена в таблице 4.

13

ГОСТ 34104—2017

Таблице 4 — Программа амплификации для идентификации ГМ линий сои 40-3-2. A5S4 7-127, А2704-12

Сталия

Температура

Время

Количество циклов

Детекция

Удерживание

95 *С

15 мин

1

Цитирование

95 ‘С

15с

45

60 *С

30 с

По каналам FAM/Green. JOE/Yellow

72 *С

30 с

Программа амплификации для идентификации ГМ сои линий MON87701. BPS-CV127-9, FG72 приведена в таблице 5.

Таблица S — Программа амплификвции для идентификации ГМ линий сои MON87701. BPS-CV127-9, FG72

Стадия

Темпере тура

Время

Количество циклов

Детекция

Hold/Удержание

температуры

95 «С

15 мин

1

Cyclng 1/ Цитирование 1

95 *С

Юс

10

60 ‘С

20 с

_

72 *С

10 с

Cycling 21 Цитирование 2

95 *С

Юс

3S

55 ‘С

20 с

По каналам FAM/Green. JOE/Yellow

72 ‘С

10 с

Программа амплификации для идентификации ГМ сои линий MON89788. SYHTOH2, DP-305423, DP-356043. MON87705, MON87708. MON87769 приведена в таблице 6.

Таблица 6 — Программа амплификации для идентификации ГМ линий сои MON69788. SYHTOH2, DP-305423. DP-356043, MON877GS. MON87706. MON67769

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание

температуры

95 *С

15 мин

1

_

Cycling/ Циклироаание

95 ‘С

1S с

45

60 *С

60 с

По канвлам FAM/Green. JOE/Yellow

Программа амплификации для идентификации ГМ сои линии DAS-44405. DAS-81419 приведена в таблице 7.

Таблице 7 — Программа амплификвции для идентификации ГМ пиний сои DAS-44406. DAS-81419

Стедия

Температура

Время

Количество циклов

Детекция

Hold/Удержание

температуры

95 *С

Ю мин

1

_

Cycling/

Цитирование

95 *С

15с

40

60 «С

60 с

По каналам FAM/Green. JOE/Yellow

14

ГОСТ 34104—2017

Программа амплификации для идентификации ГМ сои линии OAS-68416 приведена в таблице б.

Таблица в — Программа амплификации для идентификации ГМ линий сои DAS-68416

Стадия

Температура

Время

Количество циклов

Детекция

НоИ/Удержание

температуры

95 'С

10 мин

1

_

Cycling/

Цитирование

95 *С

15с

45

60 ‘С

60 с

По каналам FAM/Green. JOE/Yellow

Программа амплификации для идентификации ГМ кукурузы линий MON98140. MIR162, 5307. ВИ76. MIR604.3272 приведена в таблице 9.

Таблица 9 — Программа амплификации для идентификации ГМ линий кукурузы MON98140. MIR162. S3G7. Bt176. MIR604. 3272

Стадия

Температура

Время

Количество циклов

Детекция

НоИ/Удержание

температуры

95 'С

10 мин

1

_

Cycling/

Циклироаание

95 *С

15с

40

60 *С

60 с

По каналам FAM/Green. JOE/Yellow

Программа амплификации для идентификации ГМ кукурузы линий ТС1507. MON87460. LY038. DAS40278-9. MON89034. MON810, NK603. Т25. GA21, MON863. MON88017 приведена в таблице 10.

Таблица 10 — Программа амплификации для идентификации ГМ линий кукурузы ТС1507. MON87460. LV038. OAS40278-9. MON89034. MON810. NK603. Т25. GA21. MON863. MON88017

Стадия

Температура

Время

Количество циклов

Детекция

НоИ/Удержание

температуры

95 *С

10 мин

1

Cycling/

Циклироаание

95 ‘С

15с

45

60 *С

60 с

По каналам FAM/Green. JOE/Yellow

Программа амплификации для идентификации ГМ кукурузы линий 59122, Bt11. приведена в таблице 11.

Таблица 11 — Программа амплификации для идентификации ГМ линий кукурузы S9122. ВП1

Стадия

Температура

Время

Количество циклов

Детекция

Hold/Удержание температуры

95 ’С

10 мин

1

_

Cycling/

Циклироаание

95 ‘С

15с

50

60 'С

60 с

По каналам FAM/Green. JOE/Yellow

1S

ГОСТ 34104—2017

Программа амплификации для идентификации ГМ рапса линий GT73, MON88302. RF2. MS1. MS8, Т45. RF1. RF3. Topas19/2 приведена а таблице 12.

Таблице 12 — Программе амплификации для идентификации ГМ линий рапса линий GT73. MON88302. RF2. MS1. MS8. T45. RF1. RF3. Торав19/2

Стадия

Температура

Время

Количество ци«лое

Детекция

Hold/Удержание

температуры

95 *С

15 мин

1

_

Cycling/ Циклироаание

95 ‘С

15с

40

60 ‘С

60 с

По каивлам FAM/Green. JOE/Yellow

Детекцию флуоресцентного сигнала проводят на каналах FAM и JOE. По каналу FAM регистрируют уровень флуоресценции участка части генно-инженерной конструкции, специфичной для генома тестируемой генетически модифицированной линии, по каналу JOE — для эндогенной ДНК ГМ сои. ГМ кукурузы. ГМ рапса. Кривые накопления флуоресцентного сигнала анализируют с использованием программного обеспечения используемого прибора для проведения ПЦР в режиме реального времени (Real Time PCR).

9.5 Учет и интерпретация результатов

9.5.1    Полученные в ходе испытания данные (кривые накопления флуоресцентного сигнала) анализируют по нескольким каналам детекции с использованием программного обеспечения прибора.

9.5.2    Результаты интерпретируют на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией на графике зависимости интенсивности флуоресценции от количества циклов, что соответствует значению порогового цикла Ct.

9.5.3    Учет результатов испытания следует начинать с результатов амплификации ДНК контрольных образцов в соответствии с таблицами оценки результатов контрольных реакций (таблицы 8—11). Для положительного контроля ПЦРетаблицах результатов по каналам FAM/Green и JOE/Yellow должны присутствовать значения порогового цикла Ct соответствующих значений в зависимости от программы амплификации. Для отрицательного контроля экстракции и отрицательного контроля ПЦР значения порогового цикла Ct по всем каналам должны отсутствовать. Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (К+) или превышение граничного значения Ct. указанного в таблице. может свидетельствовать об ошибках, допущенных на этапе постановки ПЦР. 6 таком случае необходимо провести этап ПЦР повторно.

Таблице 13 — Оценка результатов контроле* для таблиц 4. 6. 8. 10

Контроля

Контролируемый этап испытании

Значение Ct по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К*

ПЦР

£ 31

£31

Проба

£ 37

£35

В образце обнаружена ДНК сои/кукурузы. если для данной пробы в таблице результатов по каналу JOE/Yeltow определено значение порогового цикла Ct £35 (таблица 13). При получении значения Ct> 35 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим испытанию из-за низкого содержания в нем ДНК кукурузы/сои.

ДНК ГМ линии считают обнаруженной, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct £37.

16

ГОСТ 34104—2017

Таблица 14 — Оценке результатов контролер для таблиц 5. 7. 9

Контроля

Контролируемый этап испытаний

Значение Cl по каналу

FAM/Green

JOE/Yellow

в-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К*

ПЦР

£21

£21

Проба

£27

£ 2S

8 образце обнаружена ДНКсои/кукурузы. если для данной пробы в таблице результатов по каналу JOE/Vellow определено значение порогового цикла Ct £25 (таблица 14). При получении значения Ct >25 по каналу JOE/Vellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК кукуруз ы/сои.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct £27.

Твблица 15 — Оценка результатов контролей для таблицы 11

Контроля

Контролируемым этап испытаний

Значение Cl по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

к*

ПЦР

£3S

£35

Проба

£40

£37

6 образце обнаружена ДНК кукурузы, если для данной пробы в таблице результатов по каналу JOE/YellowonpefleneHO значение порогового цикла Ct £37 (таблица 15). При получении значения Ct > 37 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК кукурузы.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct £ 40.

Таблица 16 — Оценка результатов контролей для таблицы 12

Контропн

Контролируемый этап испытаний

Значение Cl по каналу

FAM/Green

JOE/Yellow

В-

Экстракция ДНК

Нет значений

Нет значений

К-

ПЦР

Нет значений

Нет значений

К*

ПЦР

£31

£31

Проба

£37

£37

В образце обнаружена ДНК рапса, если для данной пробы в таблице результатов по каналу JOE/Yellow определено значение порогового цикла Ct £37 (таблица 16). При получении значения Ct> 37 по каналу JOE/Yellow для анализируемой пробы требуется повторное испытание данной пробы, начиная

17

ГОСТ 34104—2017

с первого этапа испытаний (экстракция ДНК). При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем ДНК рапса.

ДНК ГМ линии обнаружена, если для данной пробы в таблице результатов по каналу FAM/Green определено значение порогового цикла Ct £37.

9.5.4 Проверка условий достоверности испытаний

9.5.4.1    Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (К+) или превышение граничных значений Ct. указанных в таблицах 13—16, может свидетельствовать о неправильно выбранной программе амплификации ио других ошибках, допущенных наэтапе постановки ПЦР. 6 таком случае необходимо провести этап ПЦР повторно.

9.5.4.2    Появление любого значения Ct в таблице результатов для отрицательного контроля экстракции (на любом из каналов) и для отрицательного контроля ПЦР (на любом из каналов) свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа по всем пробам считаются недействительными. Требуется повторить ПЦР-исследование всех проб, начиная с этапа экстракции ДНК. атакжв предпринять меры по выявлению и ликвидации источника контаминации.

9.5.4.3    При получении значения Ct в таблице результатов по каналам Yellow и/или Green для анализируемой пробы более указанных пороговых значений Ct требуется повторно провести ПЦР-исследование соответствующего образца, начиная с этапа экстракции ДНК. При повторном получении аналогичного результата образец считают не подлежащим анализу из-за низкого содержания в нем растительной ДНК и/или ДНК ГМ линии.

Приложение А (справочное)

ГОСТ 34104—2017

Требования к ПЦР-лаборатории

А.1 ПЦР-лаборатория должна быть разделена на зоны (отдельные комнаты или помещения)для каждой из стадий ПЦР-диагностихи.

А.2 Рабочая зона ПЦР-лаборатории а соответствии с зтапами ПЦР-исследования должна включать следующий минимальный набор изолированных помещений:

•    приема и регистрации лабораторной пробы:

•    первичной обработки лабораторной пробы, подготовки анализируемой пробы (1зона. отдельный ламинар):

•    выделения НК из анализируемой пробы (I зона, отдельный ламинар).

Примечание — Помещения, где проводят работы по выделению и амплификации НК. располагают как можно двльше от помещения для детекции и учета результатов ПЦР с целью исключения движения воздушного потока и предотвращения контаминации продуктами амплификации (ампликонов), поскольку а процессе ПЦР фрагменты ДНК накапливаются а огромных количествах и являются идеальными продуктами для ревмплификации:

•    приготовления реакционных смесей, постановки ПЦР (II зона);

•    гибридизационно-флюоресцентной детекции и учета результатов испытания методом Real Time PCR (III зона).

А.З Работа а ПЦР-лаборатории должна быть организована водном направлении: от зон выделения и амплификации НК к зоне детекции и учета результатов ПЦР. В разных зонах лаборатории должны работать разные сотрудники.

А.4 Не допускается выполнение ПЦР-исследоааний в помещениях для проведения работ другими лабораторными и генно-инженерными методами (клонирование, секвенирование. рестрикционный анализ).

Все работы по подготовке испытуемых проб и выделению НК проводят в ламинарном боксе II. ill классов защиты.

А.5 Каждая рвбочая зона должна иметь свой набор лабораторной мебели, оборудования, реагентов, автоматических пипеток, расходных материалов, лабораторной посуды, защитной одежды, обуви, уборочного инвентаря и

19

ГОСТ 34104—2017

др. Имущество должно иметь маркировку, использование его е других помещениях или для проведения других работ запрещено.

А.6 Для проведения ЛЦР-исследований необходимо использовать только одноразовые микропробирхи и наконечники. Для предотвращения аэрозольного загрязнения автоматических пипеток используют наконечники с внгиаэрозольным фильтром. Пробирки и наконечники для автоматических пипеток используют однократно. При переходе от одной пробы к другой обязательно меняют наконечники с целью предотвращения перекрестной контаминации в процессе выделения ДНК. РНК или при раскапывании реакционной смеси.

А.7 Работы по подготовке реакционной смеси для ПЦР. внесению выделенных НК в ПЦР-смесь проводят а ПЦР-боксах. оснащенных ультрафиолетовыми лампами.

Регулярно следует проводить мониторинг помещений, оборудования, рабочих поверхностей, дверных ручек не наличие продуктов амплификации.

УДК 636.086.15:636.086:006.354    МКС 65120

Ключевые слова: корма и кормовые добавки, полимеразная цепная реакция, амплификация, праймеры. зонды, генно-модифицированная соя. генно-модифицированная кукуруза, генно-модифицированный рапс, экстракция ДНК. постановка ПЦР и проведение амплификации с гибридизационно-флуорес-центной детекцией в режиме реального времени (Real Time PCR)

БЗ 8—2017/183

Редактор Л.И Нахимова Технический редактор Н Е. Черепкова Корректор Р.А. Ментоеа Компьютерная верстка А.Н. Золотаревой

Сдано a набор 03.07.2017. Подписано а печать 27.07.2017. Формат 60-64^ Гарнитура Арнап. Уел. печ. л. 2.70. Уч.-иад л. 2.St. Тираж 23 мз. Зак. 1228.

Подготовлено па основе электронной версии, предоставленной разработчиком стандарта

Издано и отпечатано во ФГУП «СТАМДАРТИНФОРМ». 123001 Москва, Гранатный пер.. 4. www.90stinfo.1u